Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6302
Length(NT) : 1467
Best Gene Model Blast : Link to GSTUMT00007366001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SS1G_10536
Accession: ref|XP_001588090.1| Score: 1018 E_value: 1e-108
KEGG Definition: CAMP-DEPENDENT PROTEIN KINASE REGULATORY CHAIN
Accession: ncr:NCU01166.1 Score: 1012 E_value: 1e-108
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1113 Score: 795 E_value: 3e-85
PFAM Definition: cNMP_binding, Cyclic nucleotide-binding domain..
Pfam Number: pfam00027 Score: 217 E_value: 3e-18
Swissprot: Q01386|KAPR_NEUCR

Sequence:
>Contig6302
TTGGCCTCGGTCTAGATTTGCCTTTGGTAATGATCAGCCTCCACACCCAG
GCTCGTCGCACCTTTCCCCATCCATACACCTTTCTCCAAATTCTGCATCA
CTCGATTTCCCATCCAACTACAACATGGGTCGACGAACCTCCGTTTCCGC
CGAGTCACTAGTCCCATCATCCTCAAATGAGGAATGGAATCCCCCCGTAT
ACCCGAAGACCCCTGAACAGCTCGGCCGTTTGAAAACAGCTGTGTCTGGA
AACTTTTTGTTCATGCATTTGGATGACGACCAAAGCGGACAAGTCCTTTC
CGCGCTCATGGAGAAACCCATTCCCGGGAAAGGCACCAGGGTTATCACTC
AGGGAGATGTCGGTGACTTTTTCTACGTGGTCGAGAAAGGCTCTTTTGAT
GTTTACGTCAATAGTGCCGGCAGTATGCTTCCCGGCCTCGATGGTATGGG
CAAAAAGGTGAACTCAATTGGCCCAGGAGGGTCTTTCGGTGAATTAGCAT
TGATGTACAACGCTCCGCGTGCTGCCACCATCATATCTACAACTTCACAG
AACATCCTGTGGGCATTGGACCGCGTGACATTCCGCCGGATCTTGATGGA
AAACACATTTAAGAGACGCAGAATGTACGAGGCATTCCTTGAGGAAGTGT
CAATTCTTTCCTCCCTCGTCCCATACGAGCGCGCCAAGATTGCCGATGCT
TTGGAGCCATTCACGTTCCATCCTGGAGATGTCATTATTCAACAGGGTGA
TCCAGGCGACAACTTCTACATCATCGAGTCTGGTGAAGCGGAGGTGGTCA
AGCACGGTGCCCACGAACCGGTCAATAGGTTAACAAAGGGCGATTATTTT
GGGGAGCTTGCACTATTGAATGACGCCCCGCGTGCTGCGAGCGTTAGAGC
AGTAACCAGGGTGAAAGTGGCGACTTTAGGAAAGGATGGATTCCAGAGGC
TCTTGGGGCCTGTGGCAGAGATTATGCGAAGGAATGACCCCAGGTTAGCT
GAGGGCGTTGACCCGCTCTCCAATGTTGGAAGCCCTGGACCCTCGGGCGG
ATTTGATGGAGGAAAGGATGTTGTGGAGGAGGCTGCTGGCAGGGGGAGAG
CCGTAGAAGTCTAAGGGCATAATTGGTTCTTAAGTTTTTTTTCACTTCAA
ATGGTGAGTATCTGGCTTAGACTGCTACTCTAGAGTAGTCAGAGGCTATT
GGTGTTTCCTCCTCTTATTACCGTCTCCTTGTAACTATTCTTTCTCACTT
TCTTTTTTCTTTTTTCTTTTCGTTTCTCTCCTTTGAGATTGATGCCCATG
CATTAATGAATGGATGGGGGAAGAGCAGTGACACAGAGGGTTATAACGAA
ACTAGCAAAATGGGGCTTTCTTCTTTACCCTTTGTTCCATTCTTGCCCTG
CTTTCTTTTTTTTGCTGTCCATTTGGAAAGTTCGCAGTTATAGAGGTGGG
GGGTGTCTGAGGTGGCA

Sequences in the Contig:

SY0AAA17YF06FM1 SY0AAB34YH01FM1 SY0AAB36YO17FM1
SY0AAC14YH18FM1 SY0AAC19YK16FM1 SY0AAC38YG16FM1
SY0AAD28YO24FM1 SY0AAD63YB05FM1 SY0AAD8YD08FM1