Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig6115
Length(NT) : 1284
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An11g08030
Accession: ref|XP_001394771.1| Score: 437 E_value: 2e-78
KEGG Definition: hypothetical protein
Accession: ang:An11g08030 Score: 437 E_value: 1e-78
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig6115
TTGGATCGAAGTCTTCATTTGCGAGCCTCACTATCTCTCCATAATGGCCC
CACCTCATGTCGATGATCAGTACTCTGCGGGCTCCACCTACCCACCAAAC
TGGATTCCAGTTGTGGAGAAACCCCTACGCACCCCGAAACGAGTGAGAAT
TATTACTGTAGGTGCTGGGCATTCCGGATTAATGCTTACGTACAAGATTA
GAAACCAGTTCAAGTACGGGGACTTTATGGACCACATTATCTATGAGAAA
AACCATGATATTGGCGGAACGTGGCTTGAGAACAGATACCCAGGTACATC
CCCAAGATTAATATCCCCCATCCCCCCAGCGGGACACTTTCTAAGCCCTT
TTTTTTCGACTAGGGGTTGCCTGTGATGTTCCTGCTCATATATACACCTT
CTCATGGGAGCCAAATCCGGACTGGAGCGAGTTTTACGTTGGCGGAGAAG
AAATTTTCCAATACATGAAGCGTACAACGGCGAAATACGACCTTGCAAGA
GATGTTGTTTTCAATTCCAAGGTTGTGGAAGCCATCTGGGACCAGGGGCG
AGGTAAATGGGAGCTCAAGATTGAGCAAGAGGGACGATTTATCTGGGACG
AATGCGATATCTTTATAAACGCCTCAGGGATCCTGAATAAATGGAAGTTA
CCATCCATTGAAGGAATAAACGCTTTCAAGGGACACTTGGTGCATAGTGC
GAAATGGTGAGCTCAGGGGCCGTTCGTCAGAATTTGGGTGCTACACAGGT
TTACTGATGCTATCCAGGGAGGATACTTACGACTTTGCTGGAAAGAGAGT
TGGAATTATTGGAAACGGATCTTCCGCACTTCAGATCGTCCCCAAGCTAC
AGGAAGTCGCTGGACACCTAGTAAACTTCATGCGTACCCCAACCTGGATT
AGTGCGACATACTCTTCTGAGCTTCTTCCTGATGGAAAGAACTTCTACTA
TACAGAAGAGCAGAAGTCTGAATTCCGGAACAATCCTAAGTTGTTAAACG
AGTATCGCAAAAAAATTGAGAGCGGCTTCAACAAATTCTTCTATGCCCTT
CTCAACGACTCCCCTGCCCAAGCTGCTATAACGGAGCAGTACACACAAAT
TATGTCCGAGCGCCTCGGTAACGACCCAGAGCTTATCAAAAAATTTATAC
CAAGCTGGAGAGTTGGTTGCCGTCGTCTATCTCCCGGGGAAGGGTATCTG
GAAGCCCTGCAGGCCCCCAATGCGAAATACACATGGGATCCTATCGAGCG
CATTACCGAGAAGGGCGTAGTGACATCCGCTGGC

Sequences in the Contig:

SY0AAD22YA08FM1 SY0AAD52YO03FM1