Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig5908
Length(NT) : 786
Best Gene Model Blast : Link to GSTUMT00009544001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 268 E_value: 9e-31
KEGG Definition: hypothetical protein
Accession: ang:An11g03610 Score: 243 E_value: 3e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig5908
TTGGGTCCTAATCCCCGTATCAATCGATAAGATGGGCATTTGGCAATCAA
GAACTGGCGAGGACTATTCTTCACCGCAAGGCAGCGGCGGTTCTACTACC
GGGGCCAATATCGATGTTAGAGGCGACAATAGCGGCAACTCCGGCTCTCA
TAATAGGTTCTCCTCCCATAACATCACCACCATCTTCAATGTCTGGGGCA
CAAACTCCTCCCAGAAACATGACGAAATTTTACAATGCCTATACACATCC
AGCTACCCGTCGCACCGAGCCCGGGTTCGTGAGCCGACCGAGGGAACGTG
CACTTGGGTTACGGAACATCCGAAGTACAAGGACTGGTCGGAGAAGAAGA
AATCAGGTCTCCTCTGGCTATCGGCAGACCCAGGTTGCGGGAAATCGGTC
ACCGCTTCCTTCCTCATCACACACCTAAAGACACAGACGGATGCCATCGT
TTGCTATTTCTTTTTCAAGGACGATAGTGATGAACAAAGGAGCCCAACAT
TTGCTCTTTGCGCCCTGCTGCATCAACTATTTTCAGAGAAATTCCCTCTC
TAGACATGCCGAGCACGCCTTTAAGGAGAAAGGAAAGAGGTTCACGGAGG
AGGTGGACACATTGTGGGATATTTTGGTTACGGCGGTAGCTGAGGGGGGG
TGCGGCGATGTGATCTGTGTGGTGGACGCCCTAGACGAGTGCGAGGAAAG
GACTCTAACCCCGCTTATCCGTCACATCACCCGCCTCCCAGGATCACGGA
CTTTCAGTGTGCCTTTGAAATTTCTTGTTACGAGTC

Sequences in the Contig:

SY0AAA20YO07FM1 SY0AAC10YB20FM1 SY0AAC43YD14FM1
SY0AAC46YF04FM1 SY0AAD10YE18FM1 SY0AAD13YM04FM1