Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig5604
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57073.1| Score: 513 E_value: 2e-50
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090001000564 Score: 513 E_value: 8e-51
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 137 E_value: 2e-09
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 130 E_value: 1e-08
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig5604
TTGGACCCTACAGTCTTCTTCATATCGAAGTCTTCATTTGCGAGCCTCAC
TATCTCTCCATAATGGCCCCACCTCATGTCGATGATCAGTACTCTGCGGG
CTCCACCTACCCACCAAACTGGATTCCAGTTGTGGAGAAACCCCTACGCA
CCCCGAAACGAATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCAC
ATTATCTATGAGAAAAACCATGATATTGGCGGAACGTGGCTTGAGAACAG
ATACCCAGGGGTTGCCTGTGATGTTCCTGCTCATATATACACCTTCTCAT
GGGAGCCAAATCCGGACTGGAGCGAGTTTTACGTTGGCGGAGAAGAAATT
TTCCAATACATGAAGCGTACAACGGCGAAATACGACCTTGCAAGAGATGT
TGTTTTCAATTCCAAGGTTGTGGAAGCCATCTGGGACCAGGGGCGAGGTA
AATGGGAGCTCAAGATTGAGCAAGAGGGACGATTTATCTGGGACGAATGC
GATATCTTTATAAACGCCTCAGGGATCCTGAATAAATGGAAGTTACCATC
CATTGAAGGAATAAACGCTTTCAAGGGACACTTGGTGCATAGTGCGAAAT
GGGAGGATACTTACGACTTTGCTGGAAAGA

Sequences in the Contig:

SY0AAC5YN17FM1 SY0AAD33YE01FM1