Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig5573
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00001733001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_03632
Accession: ref|XP_001595543.1| Score: 446 E_value: 1e-42
KEGG Definition: hypothetical protein
Accession: fgr:FG02455.1 Score: 409 E_value: 1e-38
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4149 Score: 266 E_value: 2e-24
PFAM Definition: No Hit Found
Swissprot: Q4IK03|MIA40_GIBZE
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig5573
TTGGAGGTTTCATAATCCTCCCCTACAGTTACGGCTAGGCAAATGTCGGT
ACTCAGGCCCGTTGGTCGGTCGCTTCTGGGCCGCCAGATCCTCTCGACAC
CTGTGCGCCCTACAGTTCCAGCATTGCTACTAAATAATAGGTCACTTTTC
ACCCCCACTCCGGGGCAGAAGCGATCCAGCTTCAAGTCATTTGTTGCGAG
GTGGGCTGTGGCGGGTGGTTTGATTTACGCGTATGCTACTTCTAATGTTT
TTGCTGATGAGCCTAAATTCCCCCAGGATGAGCTGAAGACTATACCCCCC
GAAGACCAGGACCGCCCAAAGTCATTGCTACCCGAGAAGGGAGGGAAGTT
GGGAAGGCGGCAGAGGTCGGACGCTGAGGATGATGGGCTCTTGACCGCGG
ATGAGGCCCGAGGAGGACCGGAGGATTTGGAGGCTGAGGCGGGACAAGAG
GGGGCCTTTGATCTGGAGACTGGAGAGATTAATTGGGATTGCCCTTGTCT
TGGTGGAATGGCTCATGGTCCTTGTGGGGAAGAGTTCAAAACTGCTTTTA
GTTGCTTCGTTTTTTCGAAGGAAGATCCTAAAGGCGTGGATTGTATTGAA
AGGTTTAGGGATATGCAAACTTGCTTCCAAAAGGTGAACTGCTCATTCAT
GGGCTAAATTGAGGTCTTTGTTCTGACTTGTTTTTTC

Sequences in the Contig:

SY0AAB3YF21FM1 SY0AAC5YB02FM1 SY0AAD21YP16FM1