Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig5461
Length(NT) : 784
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211836.1| Score: 616 E_value: 3e-62
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090001000564 Score: 610 E_value: 7e-62
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 178 E_value: 5e-14
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 151 E_value: 5e-11
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig5461
TTGGCCAACTTTTGTGATACCCTACAGTCTTCTTCATATCGAAGTCTTCA
TTTGCGAGCCTCACTATCTCTCCATAATGGCCCCACCTCATGTCGATGAT
CAGTACTCTGCGGGCTCCACCTACCCACCAAACTGGATTCCAGTTGTGGA
GAAACCCCTACGCACCCCGAAACGAGTGAGAATTATTACTGTAGGTGCTG
GGCATTCCGGATTAATGCTTACGTACAAGATTAGAAACCAGTTCAAGTAC
GGGGACTTTATGGACCACATTATCTATGAGAAAAACGTAAGCTCCCCGAA
GTCGCCATTCACAGTTATCTGATTTCCACAGCATGATATTGGCGGAACGT
GGCTTGAGAACAGATACCCAGGGGTTGCCTGTGATGTTCCTGCTCATATA
TACACCTTCTCATGGGAGCCAAATCCGGACTGGAGCGAGTTTTACGTTGG
CGGAGAAGAAATTTTCCAATACATGAAGCGTACAACGGCGAAATACGACC
TTGCAAGAGATGTTGTTTTCAATTCCAAGGTTGTGGAAGCCATCTGGGAC
CAGGGGCGAGGTAAATGGGAGCTCAAGATTGAGCAAGAGGGACGATTTAT
CTGGGACGAATGCGATATCTTTATAAACGCCTCAGGGATCCTGAATAAAT
GGAAGTTACCATCCATTGAAGGAATAAACGCTTTCAAGGGACACTTGGTG
CATAGTGCGAAATGGGAGGATACTTACGACTTTGCTGGAAAGAGAGTTGG
AATTATTGGAAACGGATCTTCCGCACTTCAGATC

Sequences in the Contig:

SY0AAC15YB01FM1 SY0AAC39YA08FM1 SY0AAC39YB02FM1
SY0AAC39YJ11FM1 SY0AAC43YH23FM1 SY0AAC57YE14FM1
SY0AAD16YP06FM1 SY0AAD18YH08FM1 SY0AAD25YK04FM1
SY0AAD45YP23FM1 SY0AAD49YN16FM1 SY0AAD51YD14FM1
SY0AAD55YD15FM1 SY0AAD57YE05FM1