Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig541
Length(NT) : 1943
Best Gene Model Blast : Link to GSTUMT00006134001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: hypothetical protein
Accession: ani:AN8590.2 Score: 131 E_value: 9e-06
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3620 Score: 120 E_value: 8e-07
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 111 E_value: 9e-06

Sequence:
>Contig541
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCATCGCCACCTCTAAACTA
TTACATCTTGTTTTCATACCCTAATATTCTGCGATACTTTATCGCCTGTC
CGAGTCTTCGAAGGCGCTATGCCAAAGCTTTTCCTGCCTCCCCGCAAGAT
AAGCGAGCCATCAAAAAACACCTCCGCCGCATCTTCTACGCCTGTCGACC
CTGGCACCGGTTCCTCTCTTAACATATCATCCTCGTTGCCGCCTACTAAT
GTTCCTGTGGTGAATCCAAATACCCGTATACCCCCGGCTCCGCCGTCGAA
TACCGGCGTCGTGCCACCGACTCTGGCCCTGCCATTATCTCCATTATTTG
CGGATGGGAACCCTCACGGAAAGGCTATTACCCCCCCGACTCTCGCCAGG
CCTTCTCCTGGCCAAAATCGAAGGAAAGGCCCTCCTAGGATTGTGGCATG
CGTCTCCTGTCACAGACAGAAGAAAAAGTGTGCGGGGGAACGGCCTTGTG
CGCGCTGTGTGGCTCTCGGGGTAGCCTGTAAGGAACAAGAAAGGCCTGAT
GATGGATTTCAGTACATTCGGAAGAAGAAGAAGTTGAAAACCGCGAAAAC
CCTGGATCCATTACCCCAGCTTCCGCTTCACCCTCTAAACCATCCCACCC
CCTTTCCGGGTAGCTTGTGGACCTCCATGGGCCAGCAGGCAAGTCATGAT
AGCCCGGCTTATCAGAACCAACTTCCGTCGCCTTCGCCGTCGTTGACAAT
GGTGGGTACACCTAGCGACTCTCTATTCGAGCGTGATCTTTCTTACCAAG
GATCAGATCCCGGTGGAAATGATGAACGTCGTGACCGAAGCCCACAAGCG
GCCAGTGGTGACGTGACCCAATGCGACGATGACGAATCAACTCCAACACC
AACCCCAGTCTCGATTGAAGCACCCCCTTCTCCATCCCCCGAGCCAGACT
CAGTCGCAAACCAGCCAACTTCACACCCCATTTCTGACTATTTTGGCACT
GCTCCTGAAGCCGTCTTTGGTCCAGCTAATCTCGACCTTGGCCTTCTCGC
TGACTTGGAGGCCGACCTTGAATTGGACCTTGAGTTGTTTGGGTCCCCTG
AAAACGAGGGTTCTTCACTAGGTGGTTGCAACGCTGTTGGTACCCCAACT
ATTAGCGAGCAGACTGAGAGTACAACTCAGTTGGGCGAAGGTGGGGGGGG
TGAGACTGCCGGTAGCGGTGGATTCTCTGAATTAGAGTGGGAAGCATGGA
ACAAGAAATATTCTTCTGCCGACGTGGCCCATTCTTCTCCGTCCTTTCTC
GATCTCGGCGATGGGTTCGATTTCCTTGAGCCCCCAACTCCTAACTCACC
TGCACCAATGACTCCTGCCCATCAACACACGCCGCAACCGCAACTGGAAG
ATACCACCGTCACAAATACTGCCCAGCAACCGACACCCGAGAAGGAGGGA
GACAGACAAAGTGAGGGGGCTGCTTGATAGGGGTTTGTATTCCTGAATGT
TATCCCCGTCAAAGAAGGTTAATACGTAGCCTGGTGTGGGAAGGGGTATC
TATTTTTCTAGATGTTTCAGCTATGCAATTGGTATGAGGTCCGAGGGGGG
AAAAATGGTATGCCAAAGGTCTGGGGGGGAGAGGGGAGACAAAATGGGTT
GAATGGTTAAGCTCGTCCTTCCTTGTCGTCTTCGCCTTTCGCGGCAAACC
GACACTGGGGGAGGCGTAGCGGAGGGGTGATCACCAATCAGGTACAGTAG
TCATAGCCAGCGCAACAAAGTTTCCCTACCTTAAGGTTATGGGGTGAGTT
AGATTGTAATCATTATGCAAGTGCCAAAACAAAAAGTTGGTTCATTCCGT
GAAAATAACTTGCATTCATTTCATCGTCGCCGGTGCGTATTGAACCTCTC
TTTCTCCTTCTATGCTATTAACTTTTTCCCCCTTTTTTCCCCT

Sequences in the Contig:

SY0AAA10YC03FM1 SY0AAA21YK01FM1 SY0AAA26YG14FM1
SY0AAA36YE08FM1 SY0AAA36YE19FM1 SY0AAA40YM14FM1
SY0AAA46YG08FM1 SY0AAB20YN06FM1 SY0AAB3YD04FM1
SY0AAB55YK07FM1 SY0AAD16YA01FM1 SY0AAD1YH15FM1
SY0AAD36YG03FM1