Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig5108
Length(NT) : 1196
Best Gene Model Blast : Link to GSTUMT00008471001 E-value : 0.0
Numbers of ESTs : 26

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 391 E_value: 7e-36
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 380 E_value: 6e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig5108
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCTGTGGGTAGGATAATCG
CCACCCTTCCGAGCTCTTCTGTTTCTTCCATTCCCCCCAGACCTAGTTGA
ATATCGTCTTTAAGAATATCAAAGAACACATTCAATCCCTGCGCGGCAGA
AACAAATTCTTTCCACTGAAGCACACATCGATCACATGGGCAATCAACAG
TCAAACACGGGCTCCGAGCACTTTTCTCCAAGTGAGGGCCACGGTTCTCG
CTCTGTGGCCAACAGTAACATTCGCGGTGACGGTAGCGGCAACGTTCACT
CCAACAATAGCATCAACTCCGCCAACACTACCGTTAATTTCAACTACGGG
AACACGGACCCGTCTTGGGAGCATGGTGAAATCTTGCAATGCCTATACAC
TTCCAAATACCAGGAGCATAGAGGTCGGGTTCGTGAGCCAGCGGAGAAAA
CATGCACCTGGGTTACGGCACATCCCAAGTACAAGGACTGGCTGGGAAAG
GAAAGGTCCGGTCTTCTCTGGTTGTCGGCCGACCCTGGTTGCGGGAAATC
TGTCATCGCGTCGTTCCTGGTAAAGCATCTGGAAAGACAAGCGGACGCCA
TCGTTTGCTATTTTTTCTTCAAAGATGACAGCGATGAACAGAGGCGAGCA
ACATTTGCCCTTTGCGCAATACTACACCAACTTTTTATGCGGAACAACGC
CCTCTGCAGATACGCCGAGGGAGCGTTTAAGGGTAAAGGAAAGGGATTTA
CTGAGGAGGTCGATACATTGTGGGATATTTTGGTTAGGGTGGTAGCTGAG
GGGGGGTGCGGCAATGTAATTTGTGTGGTGGATGCATTGGACGAGTGTGA
CGAAGGGACTTTAACCCGGCTTATCCATCATGCCACCAATCTCCCTGGGT
CAGAGACTTCTTATATTCCTTTGAAATTTCTAGTTACGAGTCGCCCCTAC
CACAAGATCGAGAGACAGCTAGGCTCACCCGCAACCACCATCAGGTTGAA
AGGGGAGGAAGAGGTCACCGCTACCACTGCCGATGTTACTCGTGTCATAG
AAGCAGGGATTGAAGACCTAGAGTCATACTGGGAACAGCCCGGGGGGCTG
GGATATTTGCGAAATCTTCTCGAATCTTCCGCCGATCGGACATTCCTTTG
GGTTTCTCTTGTTCTTGATATTTTGCGGAATAGCGAGGATGGATCA

Sequences in the Contig:

SY0AAA20YM16FM1 SY0AAB20YG17FM1 SY0AAC13YF10FM1
SY0AAC17YG07FM1 SY0AAC17YP17FM1 SY0AAC18YH21FM1
SY0AAC19YH21FM1 SY0AAC22YC07FM1 SY0AAC23YB13FM1
SY0AAC23YK09FM1 SY0AAC24YI16FM1 SY0AAC27YB02FM1
SY0AAC32YD19FM1 SY0AAC35YK07FM1 SY0AAC40YD15FM1
SY0AAC49YA21FM1 SY0AAC49YN05FM1 SY0AAC50YN08FM1
SY0AAC5YK02FM1 SY0AAC6YN11FM1 SY0AAD12YJ15FM1
SY0AAD22YH23FM1 SY0AAD33YA07FM1 SY0AAD49YJ09FM1
SY0AAD51YI05FM1 SY0AAD61YI05FM1