Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig5020
Length(NT) : 1741
Best Gene Model Blast : Link to GSTUMT00006625001 E-value : 0.0
Numbers of ESTs : 292

Blast Results:

Nr Definition: hypothetical protein ATEG_06384
Accession: ref|XP_001215562.1| Score: 561 E_value: 2e-55
KEGG Definition: hypothetical protein
Accession: ang:An07g02310 Score: 550 E_value: 2e-54
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0867 Score: 382 E_value: 3e-37
PFAM Definition: GST_C, Glutathione S-transferase, C-terminal domain. GST conjugates reduced glutathione to a variety of targets including S-crystallin from squid, the eukaryotic elongation factor 1-gamma, the HSP26 family of stress-related proteins and auxin-regulated proteins in plants. Stringent starvation proteins in E. coli are also included in the alignment but are not known to have GST activity. The glutathione molecule binds in a cleft between N and C-terminal domains. The catalytically important residues are proposed to reside in the N-terminal domain. In plants, GSTs are encoded by a large gene family (48 GST genes in Arabidopsis) and can be divided into the phi, tau, theta, zeta, and lambda classes..
Pfam Number: pfam00043 Score: 146 E_value: 6e-10
Swissprot: O59827|GST2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004364 = Molecular function: glutathione transferase activity
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0042803 = Molecular function: protein homodimerization activity
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig5020
GACGGGATTCCCTTCGAAATCCTTCTCAATCATAGTTTCGTATTCTTCAA
AGCTTGAGTTCCCTGTAGATCTAAAAGTAGCAGTACTGTAAGGTGAACCT
CCCCCAAGGTCAAGAAGGTCTTCTTCTGGGTCATCCGGTTGCTTGGATTT
TTCGAATGCCTCTTTGGGGAGAGGAGGGAGGTCAGCGTCCATTCTATCTT
GGGGTATCGACGAGGCTTGTGGGTTCAGGGGCGCAGCAATTGAAGCAGTT
TTGAGATCGTCCACAAGCGACCTGCCACCTTTCAAAAGGCTACCGTTATC
ATCATCCCCCTCTGCAGGGGGTGGAGACGGCGCTTTGGGAACATCAGTTA
TCATAAGATCACCTTCAATGATCATTTCCGCTTTGCTGCTCCCCTCCTGT
TGAGCCTTTTCCTCCAAGCCCTTCCAACTTTTTTGTACAAAGTTGTCCCC
CCAACTTTTTTGTATCAGAATTGCCTCCATACCAAGTACCATCGTACTAA
AGTTTAATCGACACTCCAAGTCCCCTTCCCAATTCCAAACTCCCACAACC
CGCACAAAAAATTCACAAAATGTCTCCTCCCAGCATAACCCTCTACTCCC
ACAGGGCCGGTCCTAATCCGTGGAAGGTCGACATCGTTCTCCGCCACTTG
AACATCCCCTTCGAAACCGTCTTCATAGGGATCAACGGCGAGCACAAGCG
CCCCCCATACACCAACATCAACCCGAACGGCCGCGTACCCTCACTCATCG
ACCACTCCAACAACGACTTCACCATCTGGGAGTCCGGCGCGATAATGCAG
TACATCGTGCAGAAGTACGACAAGGAACACAAACTGCTCTTCGATAACTT
CGAGGACAACATGCACGTGGAGCAGTGGTTGATGTTCCAGATGAGCGGCC
AAGGACCGTATTATGGACAGGCAGCCTGGTTCACTCGCTATCATCCTGAG
AAGGTCCCGAGCGCGATTGACCGCTATGTGAAGGAGATAAAGAGGGTTCT
TGGCGTCCTCGACGCTTGGCTTGCGGATAAGGAGTATCTCGTCGGTGGGA
GGTTGTCTATCGCGGATATCGCGTTTGTTCCGTGGCACGAGGCGTTGGGC
TTTTTGGATAATGAGGAGGTGAATAATTGGAAGAAGGAATTCCCCAATGC
TGCGGCTTGGCACGAGAGAGTTATGGCGTTGCCGGCTGCGAAGGCGTCTT
TTGAGGCCAAGAGGAAGGCGGGTGAAGCCCAGCAGAAACAATGAGGGTTG
TCACGTGAGGATTTGTGATTGAGTGCTGCGTGCTGAGCACCGGGTGGGTT
TTGTTTCGGTTTAGTCTAGTTGAAGTAATATCTACATTAAGGGATCTCCT
ACAAAATGCATGTGATACTCTTTACCGTAGGCCGTGAAGGGGCTAGAGGA
GGGAAGCTCCTCACCATCGGTATGTAGAAAACGTACTTGGCGAGTGGAGG
GAGGATCACGTACCAAGATTGGTATTTTTGAATTTACATTATTACATGAG
GGAGCGAACGAGAGGTCTTCTACCGATTGAACAAGACATTAATTTTTTTT
TTTGTTTGGTTGGCTAACCACCGCGCTCTACCTGTTCCGTGCGAGGACAG
GGGAAAGTATAGGGAGTTTTGGCCGTCAGTTCAGGAACATAGCCACCCGC
ATCATAATTCCGGGAATAAAAGCTCCGGGTGTCTGAGGGATGTTATTAGT
TAGAAATAAAATCTGGGAATAAATAGTGAGGAATCGAACTC

Sequences in the Contig:

SY0AAA10YM08FM1 SY0AAA11YA01FM1 SY0AAA11YP10FM1
SY0AAA12YL05FM1 SY0AAA13YH07FM1 SY0AAA13YP11FM1
SY0AAA15YB11FM1 SY0AAA15YM05FM1 SY0AAA16YI03FM1
SY0AAA16YK20FM1 SY0AAA16YP06FM1 SY0AAA18YI23FM1
SY0AAA1YL01FM1 SY0AAA20YI08FM1 SY0AAA20YI14RM1
SY0AAA20YI22FM1 SY0AAA20YI22RM1 SY0AAA21YC03FM1
SY0AAA21YF16FM1 SY0AAA21YK17FM1 SY0AAA22YG13FM1
SY0AAA22YG13RM1 SY0AAA22YI04FM1 SY0AAA22YL04FM1
SY0AAA22YO22FM1 SY0AAA23YF16FM1 SY0AAA23YF16RM1
SY0AAA23YK02FM1 SY0AAA23YP18FM1 SY0AAA24YI05FM1
SY0AAA24YI05FM2 SY0AAA24YJ07FM2 SY0AAA24YJ07RM1
SY0AAA24YM20FM1 SY0AAA24YM20FM2 SY0AAA24YM20RM1
SY0AAA25YP16FM1 SY0AAA26YB16FM1 SY0AAA26YB16RM1
SY0AAA29YG08FM1 SY0AAA29YO11FM1 SY0AAA2YL08FM1
SY0AAA30YA13FM1 SY0AAA31YB20FM1 SY0AAA31YN16RM1
SY0AAA32YJ18FM1 SY0AAA32YK18FM1 SY0AAA33YM02FM1
SY0AAA33YO19FM1 SY0AAA34YI10FM1 SY0AAA34YL21FM1
SY0AAA34YN20FM1 SY0AAA34YP22FM1 SY0AAA35YF01FM1
SY0AAA35YG23FM1 SY0AAA35YL17FM1 SY0AAA36YD04FM1
SY0AAA37YH12FM1 SY0AAA38YD19FM1 SY0AAA38YH14FM1
SY0AAA39YD07FM1 SY0AAA39YF17FM1 SY0AAA39YP06FM1
SY0AAA40YH10FM1 SY0AAA40YJ06FM1 SY0AAA40YJ15FM1
SY0AAA40YN06FM1 SY0AAA41YM19FM1 SY0AAA42YI03FM1
SY0AAA42YL21FM1 SY0AAA42YN22FM1 SY0AAA43YP05FM1
SY0AAA44YH08FM1 SY0AAA46YA13FM1 SY0AAA46YA24FM1
SY0AAA46YB21FM1 SY0AAA46YH07FM1 SY0AAA46YK05FM1
SY0AAA46YO18FM1 SY0AAA48YJ04FM1 SY0AAA49YD24FM1
SY0AAA49YK08FM1 SY0AAA49YN12FM1 SY0AAA4YG07FM1
SY0AAA50YA22FM1 SY0AAA50YK18FM1 SY0AAA50YL06FM1
SY0AAA52YB05FM1 SY0AAA52YC21FM1 SY0AAA53YB24FM1
SY0AAA54YC10FM1 SY0AAA54YC14FM1 SY0AAA54YD09FM1
SY0AAA54YJ16FM1 SY0AAA54YN10FM1 SY0AAA55YH08FM1
SY0AAA55YL07FM1 SY0AAA55YL18FM1 SY0AAA56YE05FM1
SY0AAA56YJ21FM1 SY0AAA5YB16FM1 SY0AAA5YD01FM1
SY0AAA60YG10FM1 SY0AAA60YG21FM1 SY0AAA61YC02FM1
SY0AAA61YF12FM1 SY0AAA61YK19FM1 SY0AAA63YG11FM1
SY0AAA6YF16FM1 SY0AAA6YG16FM1 SY0AAA7YE11FM1
SY0AAA7YM10FM1 SY0AAA8YB19FM1 SY0AAA8YM13FM1
SY0AAA9YH15FM1 SY0AAB11YJ03FM1 SY0AAB11YK18FM1
SY0AAB12YG16FM1 SY0AAB12YL02FM1 SY0AAB12YL20FM1
SY0AAB13YC06FM1 SY0AAB13YL09FM1 SY0AAB13YP15FM1
SY0AAB14YA22FM1 SY0AAB14YH18FM1 SY0AAB14YJ05FM1
SY0AAB14YJ06FM1 SY0AAB15YB14FM1 SY0AAB16YB14FM1
SY0AAB16YN20FM1 SY0AAB16YP15FM1 SY0AAB17YC23FM1
SY0AAB17YE17FM1 SY0AAB17YL04FM1 SY0AAB18YB04FM1
SY0AAB18YF08FM1 SY0AAB18YG09FM1 SY0AAB18YJ11FM1
SY0AAB18YK13FM1 SY0AAB1YG11FM1 SY0AAB20YC15FM1
SY0AAB20YE18FM1 SY0AAB20YP11FM1 SY0AAB21YL20FM1
SY0AAB22YF11FM1 SY0AAB23YC19FM1 SY0AAB23YF10FM1
SY0AAB23YG18FM1 SY0AAB23YJ06FM1 SY0AAB23YM11FM1
SY0AAB24YO07FM1 SY0AAB24YP11FM1 SY0AAB25YI06FM1
SY0AAB26YH21FM1 SY0AAB27YB04FM1 SY0AAB27YI17FM1
SY0AAB27YK05FM1 SY0AAB28YH12FM1 SY0AAB29YB09FM1
SY0AAB29YO05FM1 SY0AAB2YC16FM1 SY0AAB2YI12FM1
SY0AAB2YI13FM1 SY0AAB2YK19FM1 SY0AAB2YM16FM1
SY0AAB30YD15FM1 SY0AAB30YG04FM1 SY0AAB30YL08FM1
SY0AAB32YE18FM1 SY0AAB32YK19FM1 SY0AAB33YC03FM1
SY0AAB33YD16FM1 SY0AAB33YK19FM1 SY0AAB33YL05FM1
SY0AAB33YM09FM1 SY0AAB34YA23FM1 SY0AAB34YC20FM1
SY0AAB34YD12FM1 SY0AAB34YG11FM1 SY0AAB34YK24FM1
SY0AAB34YP22FM1 SY0AAB35YC17FM1 SY0AAB35YJ23FM1
SY0AAB35YL12FM1 SY0AAB35YO07FM1 SY0AAB36YA14FM1
SY0AAB36YJ22FM1 SY0AAB37YC15FM1 SY0AAB37YN19FM1
SY0AAB38YE05FM1 SY0AAB38YJ19FM1 SY0AAB39YB09FM1
SY0AAB39YI04FM1 SY0AAB39YK14FM1 SY0AAB39YL06FM1
SY0AAB39YM01FM1 SY0AAB39YN16FM1 SY0AAB3YI09FM1
SY0AAB3YL23FM1 SY0AAB40YA15FM1 SY0AAB40YK14FM1
SY0AAB41YC16FM1 SY0AAB41YO16FM1 SY0AAB41YP10FM1
SY0AAB42YP20FM1 SY0AAB43YD19FM1 SY0AAB43YE11FM1
SY0AAB43YG13FM1 SY0AAB43YI13FM1 SY0AAB43YI23FM1
SY0AAB43YM07FM1 SY0AAB43YO14FM1 SY0AAB44YA15FM1
SY0AAB44YD19FM1 SY0AAB44YI23FM1 SY0AAB44YL23FM1
SY0AAB44YM09FM1 SY0AAB45YA11FM1 SY0AAB45YJ16FM1
SY0AAB45YL07FM1 SY0AAB45YL10FM1 SY0AAB46YF22FM1
SY0AAB46YJ20FM1 SY0AAB47YC10FM1 SY0AAB47YK11FM1
SY0AAB48YD06FM1 SY0AAB48YJ04FM1 SY0AAB48YP06FM1
SY0AAB49YG06FM1 SY0AAB4YH21FM1 SY0AAB4YO08FM1
SY0AAB50YC11FM1 SY0AAB50YC18FM1 SY0AAB50YF11FM1
SY0AAB50YJ03FM1 SY0AAB50YL17FM1 SY0AAB50YP22FM1
SY0AAB51YA15FM1 SY0AAB51YD01FM1 SY0AAB51YE06FM1
SY0AAB51YE08FM1 SY0AAB51YG16FM1 SY0AAB51YN11FM1
SY0AAB52YD09FM1 SY0AAB52YE18FM1 SY0AAB52YN03FM1
SY0AAB53YK03FM1 SY0AAB53YL06FM1 SY0AAB53YN22FM1
SY0AAB53YP10FM1 SY0AAB54YF14FM1 SY0AAB54YG08FM1
SY0AAB54YG14FM1 SY0AAB54YJ05FM1 SY0AAB54YN22FM1
SY0AAB55YI06FM1 SY0AAB55YM08FM1 SY0AAB55YO06FM1
SY0AAB55YP17FM1 SY0AAB56YB21FM1 SY0AAB56YF15FM1
SY0AAB58YB12FM1 SY0AAB58YD06FM1 SY0AAB58YE15FM1
SY0AAB58YL10FM1 SY0AAB58YM18FM1 SY0AAB58YP10FM1
SY0AAB59YC16FM1 SY0AAB59YE11FM1 SY0AAB59YN12FM1
SY0AAB5YE21FM1 SY0AAB5YN04FM1 SY0AAB60YA20FM1
SY0AAB60YE10FM1 SY0AAB60YG01FM1 SY0AAB61YA09FM1
SY0AAB61YB01FM1 SY0AAB61YG09FM1 SY0AAB7YD22FM1
SY0AAB7YD23FM1 SY0AAB7YG04FM1 SY0AAB7YH14FM1
SY0AAB7YI03FM1 SY0AAB7YI15FM1 SY0AAB7YJ14FM1
SY0AAB7YN12FM1 SY0AAB8YH05FM1 SY0AAB8YM22FM1
SY0AAB9YE11FM1 SY0AAB9YE18FM1 SY0AAB9YP16FM1
SY0AAC46YI18FM1