Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4737
Length(NT) : 422
Best Gene Model Blast : Link to GSTUMT00000199001 E-value : 1e-109
Numbers of ESTs : 2

Blast Results:

Nr Definition: heat shock protein (Sti1), putative
Accession: ref|XP_001262823.1| Score: 264 E_value: 6e-22
KEGG Definition: heat shock protein (Sti1), putative; K09553 stress-induced-phosphoprotein 1
Accession: afm:AFUA_7G01860 Score: 264 E_value: 3e-22
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0548 Score: 213 E_value: 1e-18
PFAM Definition: No Hit Found
Swissprot: Q9USI5|STI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4737
TTCGGTATAATACTAACTTGCACCGGTCTTGCAAACAAAAGCGGTAGTGC
AAGTGAATAAATATCGGGAAATACTGAACCGAATGTGTATACATCAATCC
CCGACCAATCAATCAATCAAGTATTAACCTTGGCTATAGTGCTAAGGGGA
AAAAAAATGAAGGAAAGAAGAAAGAGTAAAACGGAATCACAAATCCCTCC
CTCACAAACCATCCAACCAACTAGCCAATCCTAATAATCCCGGCAGCCAT
CAACTTTTGCACCTTCCCCCTGACAACCGGGTTCTTCATATGCTCGGTAA
GCGCGGCAGGGTCCCTCTTAGCTTGCTGTAGGATGCTCTGCATGACGGGG
TCGGAAATGATGGCGACGATCTCGGGATCCTTTTGAATCCTCTCCATTGT
CTGCTCTTCGGTCTCGCCCCAA

Sequences in the Contig:

SY0AAA22YG15RM1 SY0AAC3YJ11FM1