Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4734
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00008471001 E-value : 1e-111
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4734
TTGGGGGTTAGGGGCGGTGGTTCATGGAGTATTGCGGGGGGGCGGATATG
TGAACGCCCGATGCGAACGGTATGGCACGGCATTGAACATAGCAGCTTTC
CGGCGAGACGAGGGCATTACCGCAATGCTGCTGGAGGGGAATGTCGGGGC
GTATATATGTGGGAGGGAGTATAATATCTTGCATACGGTAAGTGAATTTA
ATGTGATTCAGGGGAGTCAGAGCTGATACAGGAGCGGTTTTACACAGAAG
CGGGTAGGTGATCGGTATACGGGATGTTGGGCGACCAGAAGGACTAACGC
CGGATTGACCCATGAGTGTAGAGTGAGGTATGGAACCCGGTAAATAGCTC
TGGGGGCGGAGGTGGCGGCTAATGGCGAAATGCGGGGTGTTCTAGCTGTG
TTGTAGGAAGTAAGTGAACAGAGTCGACAACGGTTCTAGGGCGAGGCGAT
TGCTGACCACCGACTCACTAAATGTTAAAGAAGCTGCGAAGTGTAAGCGA
ACAGGAACAACCACGGCTCGGCGGCGAGGCAATTGCTGACACGTGACTCG
TTGAATGTTGTAGATTTTGGATGAAAGAGATGTAGGTGACCCTGATCAAC
TATGGTTCCGGGGCGAGGA

Sequences in the Contig:

SY0AAC3YF06FM1 SY0AAD11YD24FM1