Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4599
Length(NT) : 3550
Best Gene Model Blast : Link to GSTUMT00006483001 E-value : 0.0
Numbers of ESTs : 63

Blast Results:

Nr Definition: hypothetical protein SS1G_07287
Accession: ref|XP_001591841.1| Score: 3404 E_value: 0.0
KEGG Definition: hypothetical protein; K05658 ATP-binding cassette, subfamily B (MDR/TAP), member 1
Accession: ani:AN2300.2 Score: 3241 E_value: 0.0
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0055 Score: 2942 E_value: 0.0
PFAM Definition: ABC_membrane, ABC transporter transmembrane region. This family represents a unit of six transmembrane helices. Many members of the ABC transporter family (pfam00005) have two such regions..
Pfam Number: pfam00664 Score: 413 E_value: 2e-40
Swissprot: P36619|PMD1_SCHPO
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0005524 = Molecular function: ATP binding
GO:0042626 = Molecular function: ATPase activity, coupled to transmembrane movement of substances
GO:0006855 = Biological process: multidrug transport

Sequence:
>Contig4599
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGGGAGTAGGTTTTTGGTT
TCGGGCGATACAAACTTGAGTGCTATCCTGACTGTGTTGCTGGCTGTAAT
CATTGGAGCATTCTCCCTTGGAAATGTTGCGCCAAATAGTCAGGCGTTCG
CCACTAGTGTTGCCGCGGCTGCAAAGATTTTCGGTACTATCGACCGTGTG
TCGCCACTTGACCCTGATGCTGATGGGGGTGAGAAGCTGAAGCATGTTGA
GGGCACTATCGAGCTCAGGAACGTTAAACACATCTACCCATCTCGACCCG
AGGTTCCCGTGATTCACGATATGAGCCTTATTGTCCCTGCTGGAAAAGTG
ACCGCGCTTGTTGGTGCCTCTGGTTCAGGAAAGTCGACTATTGTGGGTTT
GGTAGAGAGGTTTTACGACCCCGTTGGTGGCAGTGTATACCTCGATGGAC
ACGATATCAGCCAATTGAACTTGAGGTGGCTTCGGGAGAACATCTCTTTA
GTTTCGCAGGAGCCTGTCTTATTTGGAACGACCATCTTCAAGAACGTCTG
CCACGGATTGATTGGAACAGAATGGGAAAATGCCTCTGAGGAGGAAAAGC
GGGAACTTGTCACCAATGCTTGTATCATGAGCAATGCGGACACTTTTATC
AGAAGCCTCCCGGAAGGATATGATACAAATGTCGGTGAACGTGGGTTCTT
GATGAGTGGTGGACAGAAGCAGAGAATTGCGATCGCCAGGGCTGTTGTCA
GCGATCCCAAGATATTACTGCTAGACGAGGCTACTAGTGCGCTTGATACC
AGAAGCGAAGGTGTTGTGCAGGCTGCTTTGGACAAGGCGAGTATGGGACG
AACGACTATTGTAATTGCTCATCGTCTGTCAACCATCAAAACTGCTGATA
ACATCGTTGTCATGTCTGAGGGTACCATCGTCGAATCCGGCACCCATGAC
GAGCTTTTGGAGAGGAGAAGTGCATATTACAATCTTGTTGAAGCCCAGCG
AATCTCGGCTGAAACTGAAAAATCTGCTGTGGCCGGTGACATCTCTCACG
CCGACGATGATGAAAAGCTCAAATTGACACTTTCACGGTCTAAGACCAAG
GGCCTTAGCGTTGCGGACCCAGGAGATGCGAGCATTGCGGATAAACTCAA
CAGAACTGCCACGAGCAAGTCGAAGTCCCACATTGCATTGGAGAATAGGG
CACCGGAAGCCAAGCCCGAATATGGGCTTTGGGAACTTATTAAGCTTACT
GCTTCTTTCAACTCGAATGAAAAGTTTTACATGTTTGTCGGTCTCTTCTT
CTCTATCATTGCTGGGGGCGGCTACCCCACTCAGGCTGTGTTCTTCTCAA
AGTCCATTGTTGCGCTTTCTCGTCCCCCTTCTGAATATGGCCAACTTCGC
AAGGATGCAAACTTCTGGTCCGCCATGTATCTCATGCTCGCCATCGTTCA
ACTTATCGCCTACCTTTCCCAGGGCCTTGCTTTTGCTTACTGCTCCGAGA
GACTCGTCCACAGGGTGAGGGATCGTGCATTCAGGACCATCATGAGACAG
GATATTGCCTATTTTGATCGTGAGGAGAACTCTACTGGTGCCCTTACTAG
CTTCTTGTCCACCGAGACCACCCATCTTAGTGGTATGAGCGGTGTCACGT
TAGGAACGCTCCTCATTGTTACCACCACCCTTGTTGCGGCTATCGCGGTG
AGCTGCGCGATTGGATGGAAGCTTGCCTTGGTCTGTACATCGACTATTCC
GATTCTATTGGGATGCGGTTACTTCCGTTTCTGGATGTTGGCCAAATTCC
AGCGTAGGAGTAAGAAAGCCTATGAGAAGTCTGCCGGTTTTGCTTGCGAG
GCTACTGCGGCTATCCGCACCGTTGCTAGCTTGACCCGCGAGAAGGATGT
TTGGGACCATTATCACTCGGAGCTCAAGAACCAGGCCCAGAAGAGCTTGG
TTAGCGTTCTCAAGAGTTCTACTCTTTACGCTGGTTCCCAATCTTTTACT
CTCTTGTGCGTTGCCCTTGGGTTCTGGTATGGGGGTACTCTAATCAAGAC
TGGAGAGTACAACATGATGCAATTCTTCTTGGTTTTTGCAAGTATCATAT
TTGGTGCTCAATCTGCAGGAACCATCTTTTCGTTTGCCCCAGATATGGGT
AAAGCCAGACATGCCGCTTCTGAGCTCAAGACTTTGTTTGATCGCAAGCC
CGAGATTGATACCTGGAGCGACGATGGAGCGCCTGTTCCGGAGATGGAAG
GTAATATCGAGCTCCGCGACGTTCACTTCCGTTACCCCACCCGCCCTGAG
CAGCCCGTACTTCGTGGGCTGGATTTGGTTGTTAAGCCCGGACAGTATGT
TGCACTTGTTGGGCCTTCTGGATGCGGAAAGAGTACTACCATCAGCTTGA
TCGAGCGCTTTTATAATCCACTTGCCGGTGGTGTCTACGTTGACGGCCGT
GAAATCTCTACCTTAAACATTAACCAGTACCGCAAGCACCTCGCCCTCGT
CAGCCAAGAACCAACTCTCTACCAAGGCACCATTCGCGAGAACATCCTCC
TCGGCGGTGACCGCAACGACATCACTGATGATGAGATCACTGCCGCTTGC
AAGTCCGCGAATATCTATGACTTCATCCAATCCCTCCCGGAGGGCTTCCA
GACTGTTTGCGGTTCCAAAGGTGCTCTCCTCTCTGGTGGACAGAAGCAAC
GAATTGCCATCGCCAGAGCTCTCATCAGAAACCCGAAGGTTCTACTCTTG
GACGAAGCTACATCCGCCTTGGATTCCGAGTCCGAGAAGGTTGTGCAGCA
GGCACTTGATACCGCCGCAAAAGGACGAACAACTGTGAGCGTTGCCCACC
GTCTATCCACTATCAAGCACGCAGATTGCATCTATGTCTTTGATGCCGGA
CGAATTGCCGAGAGCGGAAGCCACTCGGAGCTCATGGCTAAGCGTGGAAA
ATACTACGAGCTGGTCAACCTCCAATCACTCGGGAAAAACAATTAGCCTA
GCATTTGCACCATGTGGTAGTTTCCCACTTGCCACCACCTTCTCCCCGTC
CCTTCCTTCGTCATATCTTTTTTCCTTAACTAATGGTGGACATGATATCT
TTTGGTTCTTTTAATCTCCATTTTGGCTTTTCTCGAGTTTTTTTTTTTTT
CCACACTCCCAAAAATCTTTTTCAATTCAAATGCCTTATTACTATTATTG
TGGCGGGTAGAGATCTCTTTTCTTTCTCCTGTTTTTATTTGTTGGCGTTT
TGGTCCCGTAGATTTTTTTCCTCGCTATTTGTAAGGTATGAGTACTGTAC
ACAGTACACACTTGTATGGATGATTACGATTGTTGTCGCGGCGGAATTTT
TAACAGATTGGGTAGGCGTTTGATGGACATTAGTTAACCAAGTCCCGGAA
AACAAGAGATTTTGTCAAGGTGTGGAGTTGTGGGTTCTTGGTGGGTGCCT
CGCGCCATACTGGGCTGTAGTACCGGTAGTACAAATCTGGAAACACAATA
CCGGTACCGGTATCATATGTACTCACATTTAAGATGATGGAACGTGGAAA

Sequences in the Contig:

SY0AAA16YH24FM1 SY0AAA16YI22FM1 SY0AAA20YF05FM1
SY0AAA22YP19FM1 SY0AAA25YA17FM1 SY0AAA26YD13FM1
SY0AAA26YE07FM1 SY0AAA30YM02FM1 SY0AAA33YJ03FM1
SY0AAA35YD23FM1 SY0AAA36YF06FM1 SY0AAA43YM16FM1
SY0AAA43YN04FM1 SY0AAA44YD24FM1 SY0AAA46YC11FM1
SY0AAA46YO19FM1 SY0AAA47YM12FM1 SY0AAA54YM02FM1
SY0AAA58YN21FM1 SY0AAA60YG09FM1 SY0AAA60YO09FM1
SY0AAA62YJ13FM1 SY0AAA63YN06FM1 SY0AAA6YE17FM1
SY0AAA6YJ09FM1 SY0AAA8YE03FM1 SY0AAB11YG17FM1
SY0AAB12YC21FM1 SY0AAB15YJ01FM1 SY0AAB21YN09FM1
SY0AAB24YM19FM1 SY0AAB27YO09FM1 SY0AAB28YN21FM1
SY0AAB31YE24FM1 SY0AAB3YB04FM1 SY0AAB3YM04FM1
SY0AAB40YB09FM1 SY0AAB40YJ04FM1 SY0AAB41YM10FM1
SY0AAB42YE01FM1 SY0AAB43YH21FM1 SY0AAB45YB12FM1
SY0AAB48YM04FM1 SY0AAB49YO13FM1 SY0AAB4YP10FM1
SY0AAB50YM11FM1 SY0AAB54YE23FM1 SY0AAB55YB05FM1
SY0AAB55YM09FM1 SY0AAB60YL22FM1 SY0AAB61YF10FM1
SY0AAB6YF02FM1 SY0AAB6YO16FM1 SY0AAC10YO10FM1
SY0AAC36YF03FM1 SY0AAC36YI12FM1 SY0AAC40YO06FM1
SY0AAC44YK04FM1 SY0AAC59YM12FM1 SY0AAC7YF13FM1
SY0AAC7YO07FM1 SY0AAD45YG15FM1 SY0AAD5YF22FM1