Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4598
Length(NT) : 791
Best Gene Model Blast : Link to GSTUMT00000459001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: hypothetical protein SS1G_04067
Accession: ref|XP_001594260.1| Score: 763 E_value: 3e-79
KEGG Definition: hypothetical protein
Accession: ang:An18g06680 Score: 734 E_value: 3e-76
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0185 Score: 649 E_value: 1e-68
PFAM Definition: Proteasome, Proteasome A-type and B-type..
Pfam Number: pfam00227 Score: 255 E_value: 5e-23
Swissprot: Q9USQ9|PSB4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4598
TTGGATCTAGACTATCTCTCTCCACCCACTCGAACACCTCCACCGATCCA
TCCCCGGGTGCTTTCCACAACCACCGCTCATCTCCAATCCATCAACCTGC
AACCATACCCAAAGCTTTATCCCACCTACTGTCTACCGCAGCAGTTTCCA
CACTATGAACCACCTCCCAGAAGCGTGGGGTAGACCCAGAAACGACGTTT
ATGGTACATACGACGCCTCGTATTTGCAATCTTCTATGCCGAACCAGCAT
ACCCAGTCTCCGATTGTTACTGGCACCAGCGTTGTTGCGCTCAAGTTCAA
TGGCGGGGTTGTTATTGCTGCTGATAATCTTGCTTCCTACGGTTCCCTCG
CCCGCTTCACCAATGTTGAGCGTCTGAAGCAGGTTGGGACTCACACTGTT
GTTGGTGCCGGGGGTGACATCTCGGATATGCAGTATTTGCACGAGAAGTT
GTTAGATTCCTTAATCATTAAGGAGGAGTACCAGAACGACGGACACCATC
TGCGTGCCTCGCATATTTACAGGTACCTTAGCAAGGTGTTGTACCAGCGT
CGTTGCAAGTTCGATCCCCTGTGGAATACCTTACTGGTTGCGGGGTGGGA
TGATGGCAAGCCATTCTTGGCTTCGGCGGATCTTCTAGGAACTACTTTCT
CCGCCCCCGCTCTAGCCACCGGATTTGGCGCGCATCTCGCTGTCCCCCTA
CTCCGCCGTGTTTGCCCAGACGAAGCCGCCGTTGAGAACATCACTCGTGA
ACAGGCGGTTGACACTATTGAGGAGTGCATGAAGGTGCTCT

Sequences in the Contig:

SY0AAA24YH19FM1 SY0AAA24YH19FM2 SY0AAB17YM02FM1
SY0AAB19YO19FM1 SY0AAB30YM08FM1 SY0AAB31YP21FM1
SY0AAB39YP13FM1 SY0AAB40YC07FM1 SY0AAB53YG17FM1
SY0AAB54YK10FM1 SY0AAB59YN07FM1 SY0AAB59YO16FM1
SY0AAC20YP13FM1 SY0AAC33YC06FM1 SY0AAC36YC01FM1
SY0AAC36YE12FM1 SY0AAC4YK23FM1 SY0AAD43YD23FM1
SY0AAD63YH03FM1