Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4597
Length(NT) : 1763
Best Gene Model Blast : Link to GSTUMT00002653001 E-value : 0.0
Numbers of ESTs : 45

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56168.1| Score: 924 E_value: 2e-97
KEGG Definition: voltage-gated shaker-like K+ channel, subunit beta/KCNAB
Accession: aor:AO090005001219 Score: 924 E_value: 9e-98
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1575 Score: 700 E_value: 4e-74
PFAM Definition: Aldo_ket_red, Aldo/keto reductase family. This family includes a number of K+ ion channel beta chain regulatory domains - these are reported to have oxidoreductase activity..
Pfam Number: pfam00248 Score: 419 E_value: 1e-41
Swissprot: O14295|PLR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0016020 = Cellular component: membrane
GO:0005634 = Cellular component: nucleus
GO:0050236 = Molecular function: pyridoxine 4-dehydrogenase activity
GO:0042821 = Biological process: pyridoxal biosynthetic process

Sequence:
>Contig4597
TTGGATTGTTATTATTATTATTATTACCCCGGTATCGTACATGCCGCCAA
ACGTGGTCCAGTATCTATATTTTACCATACTCTACTAAAACCTACCGCTC
ATATTGTCTGAAAGTCCCAGCGTATCATGCGATAGTATCATAGGTTTTGG
TGGTTGATACAAGTGTGGTACCGTACTTGCACGAAAAAGCCAGCATCACA
AGCGGTGGGTGATCGTTGTCGAGTTTAGTGAGGTTTAGGGACTTTTGCCA
TCAGGCTACCGGGGGGGGAGAGAAAGCACGATACACGATCGCCACACCCG
AACCTTTCCTAATCCCGGAATATTCTACGATACCACAGGGAACCAAAAAG
CGACAAATACAGACGAGGGATAACGGCCGGATACAGTACCGGACCACTTC
AAACTCATTATTTCACCCTTTTAAGAAATTGTGGGGGGAGAACGGTAAAC
AAGGATGCTTGGATGGAGTTATCGGTATTACGGTAATCCCGCGGGAGGGC
AAAAGGCATAACCGGTAGCAAGTCCTCCACCAGCAAACCTGGTTTCATCC
CGCCAAAGATCGATGACCATATAACATGCCGAATCTCCTCTCTCCCGACT
CGAAATCGATCCTTAAGATACAACTTGGGGACAACCTCAAGGAAGAAAAA
AAAATTCAAACAAAATGGTTATCATCAACAATATACCCGTCGGCAAAACC
GGCTATGGGCTTCTGGGATTCACCTGGAGACCCCACCAGACACCCGACGA
ACAGGCTTTTGCAGCAATGAAGAAAGCCATCGAGAAGGGCGCCATCTGTT
GGAACTCTGGCGAATTCTACGGCACCCCGGACCCGACCCTCGGCCTCCAA
CTCCTGCACCGCTACTTCAAAAAGCACCCGGAGGACGCTACCAAAGTCGT
CCTGAGCATCAAGGGCAGCGTGGACATCTCGACCCTCAAGCCCCTGGGAT
CCCCCGCCGACGTGCGCAAGTCCGTGGAAAACACCCTGCGCATCCTCGAC
GGTGTCAAGAAGGTCGACATATTCCAGTGCGCGCGGGTGGACCCCAAAAC
ACCCGTGGAGGAGACCGTGGGCGCGCTGGCCGAGTGCGTGAAGGAGGGGA
AGATCGGGGGTATTGGGCTCAGCGAGGTTGGCGCCGCCACGATTCGCAGG
GCCCACGCCGTGCATCCCATCGCAGCGGTCGAGGTCGAGTACTCGCTCTG
GGCGACGGAGATACGCACGAACGGCGTCGCCGGTGTCTGCGCCGAACTCG
GTATCCCCATCGTCGCCTATAGCCCGCTCGGGAAGGGGTTCTTGACGGGG
GAGATAAAGTCGCCGGACGATCTCCCCAAGAATGACTTCAGGAGGCACTT
CAGTAGATTCCAGCCCGAGAACTTTAAGGTCAACATCGAGCTCGTGAATA
AGGTTGGCGGTCTTGCGAAGAAGAAGGGATGCACGCCCGCGCAGTTGGCG
ATGGAGTGGGTGCGGTACCAGAGTGGGAGGGATGGGATGCCGGATTTGTT
ACCGATTCCCGGGGCGACTGCTGCGGAGAGGGTTGAGGAGAATTGTCAAG
AGGTTGGTCTCACGGAGGAGGAGTACATGGAGCTTGAGGGGATAGTTGGG
AGCACCCAGGTCTTGGGAGGGAGGTATTTCGAAGCAGCTGAGTCTCTTTT
GTTCGCCTAAGGCCTGTACGTAGGGCACGGCCATGAGTAGCTGCTCCTAA
ATAATTTGCATTGTACCCCAGTCACCTGGCAGAGCATAGGTAGAAATAAA
CACATATTCATGT

Sequences in the Contig:

SY0AAA12YC16FM1 SY0AAA14YG18FM1 SY0AAA23YN12FM1
SY0AAA25YO21FM1 SY0AAA25YO21RM1 SY0AAA30YC07FM1
SY0AAA31YI12FM1 SY0AAA35YP11FM1 SY0AAA36YN02FM1
SY0AAA38YL16FM1 SY0AAA50YO22FM1 SY0AAA53YM02FM1
SY0AAA57YF02FM1 SY0AAA62YH11FM1 SY0AAA6YJ21FM1
SY0AAB10YP24FM1 SY0AAB11YA10FM1 SY0AAB11YP24FM1
SY0AAB12YN09FM1 SY0AAB16YK17FM1 SY0AAB36YM20FM1
SY0AAB38YP09FM1 SY0AAB40YL01FM1 SY0AAB40YN20FM1
SY0AAB43YO11FM1 SY0AAB50YN24FM1 SY0AAB59YE16FM1
SY0AAC17YB13RM1 SY0AAC21YI16RM1 SY0AAC27YH21FM1
SY0AAC27YH21RM1 SY0AAC34YJ11FM1 SY0AAC36YE10FM1
SY0AAC37YB10FM1 SY0AAC38YI17FM1 SY0AAC40YD09FM1
SY0AAC46YE08FM1 SY0AAC51YL11FM1 SY0AAD11YJ07FM1
SY0AAD20YA09FM1 SY0AAD32YC07FM1 SY0AAD35YJ14FM1
SY0AAD38YL18FM1 SY0AAD44YC08FM1 SY0AAD61YF11FM1