Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4596
Length(NT) : 1129
Best Gene Model Blast : Link to GSTUMT00011152001 E-value : 1e-171
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_01035
Accession: ref|XP_001560203.1| Score: 219 E_value: 4e-26
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g641 Score: 196 E_value: 3e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4596
TTGGCACACACACCCACCACCGGGAAAATAGAACTTTTCATCTCTACCGA
ACTGAACCTACATTTTCTTTCTTTGATTCCTCTGCGTTATTTGTGAAATT
GATCAATACTCACCAGTCCCTATTATCAGGCAATTACTTTCTGGTATATC
GTGAAGGTAAAGTGAGTTAGCGGGTAGGGCACAGTGCGTAGTCAAACCAC
CATCCGGGAAAAGGGAAGGAAAAGAAAACCCCCAAACACCGGTATGGTCG
CACCTAAACCCGAACTGCGGCGTTCTTTTGATGATCGAGAGGGGCACTCC
AATAGGCTTCGAGGCCATCGCCTAAGCCCGCTCCGCTACCCTAAAGGACT
ACATCAAGGACATTGGCAAAGCTTTTCAATCCTTCTCGACCACGATTGCC
CACGGCTCCGCCAACACCCCTATCGAACAGGGGCCCATCGCTATAATCGC
CTCTTGCACGAACCACGAACAATGCACCCTGTTCGTCTCTCGCCCCATGG
ACGGCACCCAACGCAAAGAATACCGCCGCTTTTCACAATGCTATGAGCGT
CTCGGCTATCTACGGAGACTCATGGGGGAGCAATCCAAAAACTATGAGCA
CCACGAGCACTCATACGTCATCTCCCGCCGTGGCGTCTACCACCGCACCG
ACATGAACAAGATCAGCCCAACAATAGACGACTTTGGCACAACCCCCGTC
GACGGTGAACCCGACACGCCAGTTCAAAGCCCAGTGGGTAGACGGTGTCA
CAACTACGCAATTACAGTCTAACCCTCTCGCCCATCATCTTCTCACCTAT
AAAACGCGATGGGGATGTCATACTCGACGTGTACCCTCCGACAGGCTCCA
CCGAACGCTTGGTTGTCCCTAAGAGCCTCGGAAAAATGGAGTACAGAGAC
ATGAGGAAGAGCGGATGGGTTGACCTCTGCTTGGAGCGAAATCTCGCACA
AGGCGGAACATAAAGATTGGCCATGGCAACAAGAAGCTTAAGTCGGTTGC
CATCATGGTAATGAAACCTAAAGGAAGCGCAAAAGAATGAAGTGTGAGGG
TGGAATCACGATAGACGATAAGTGGAGATGAACACGGAAGGAGGGAAAAT
TCATGACTGACAACCAACCTCCTAGCTAA

Sequences in the Contig:

SY0AAA15YG02FM1 SY0AAB11YL23FM1 SY0AAB29YE02FM1
SY0AAC36YE05FM1 SY0AAD24YL23FM1 SY0AAD33YF23FM1