Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4595
Length(NT) : 980
Best Gene Model Blast : Link to GSTUMT00007323001 E-value : 1e-114
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001586289.1| Score: 497 E_value: 3e-48
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4595
TTGGGGCGCAAGTAAGCACCTAAAGAATAAGCCATCATCCTCCTGCTCCA
CAATCATCCCCAAAAATGCCAAACAGAGTCCCAGTCCCAGACACCGGCAA
GTTAAACGGTCACTGGATTCTTGGCGAAATCCTCGACCACATATCCGATT
TCTTCGACGACTTCCCCAAAATCGACTTCGACGACCTAAGCAAGCTTGTC
TCAGACGTCCGCGACCATAAAGCCGACACAGAGACCCAACTCCGGCTCTT
CCTGAAAGTCTTCCGAAATACAAAGGAGTACAAACAATCCTTCAAAATCC
TCGACCACCGGGTCAGAGAGCAAATCGACAAATTCATAGACGGCCATTCC
GCATCGGATGTCACGCAGTCCGGGTTCGAAGTCCTTCCCAGCCCCGCTGC
TATCCACCACTTCAGTGTCCTGGAATCCAGCCTTGGGCGGGAGAACGTGC
CCAAGATCTATGAGGACAAGGACGGGAAAAAGGTCATGGAGGTGTACGCC
GATAAGAACTTCGACAACTGGGGGTTGACAGTACGGAATAAACCAAAATT
TACGTTCGTTCCAACAACCATCCTTGGATTGGAGAACCTCGTGAAGTACG
CCAAGGAGAAGGGCATCCGTGTCAGGTGTAGTGGCTACAGACATACTTGG
GCCCCCATGTTCTCCGCCGACAACGAGATCTTGGTCTCGCTGTTGAATAT
TCAGAAGGCGACGCAGGTTCCGGATGACTCGACGCTGTTTCCTCCTCCAC
AGTCGAATGCATCGAACGAGCTTAAGAGTATTCAACTTGATGACCTTACG
CCTGTTTCGAAGCCGGGGAATAAATGCGTTCGTGTTGGCTCTGCGGTCAC
CGCGGATGAGTTTAGGAGGTGGCAGATTGAGCACAAAACTTGGGCGTTGC
CGATGGATGTTATCCTTGTTGAAGTCACTATGGGTGGAACAAACGCCCCC
ATCTGTCACGGTGCCGGGCGTCAACACAAG

Sequences in the Contig:

SY0AAA35YF09FM1 SY0AAA7YO08FM1 SY0AAC36YD04FM1