Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4594
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00002876001 E-value : 0.0
Numbers of ESTs : 23

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_505757.1| Score: 267 E_value: 5e-22
KEGG Definition: hypothetical protein
Accession: yli:YALI0F22605g Score: 267 E_value: 3e-22
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3006 Score: 276 E_value: 1e-25
PFAM Definition: Transthyretin, HIUase/Transthyretin family. This family includes transthyretin that is a thyroid hormone-binding protein that transports thyroxine from the bloodstream to the brain. However, most of the sequences listed in this family do not bind thyroid hormones. They are actually enzymes of the purine catabolism that catalyse the conversion of 5-hydroxyisourate (HIU) to OHCU. HIU hydrolysis is the original function of the family and is conserved from bacteria to mammals; transthyretins arose by gene duplications in the vertebrate lineage. HIUases are distinguished in the alignment from the conserved C-terminal YRGS sequence..
Pfam Number: pfam00576 Score: 302 E_value: 1e-28
Swissprot: Q06S87|URAH_DANRE
Gene Ontology:
GO:0033971 = Molecular function: hydroxyisourate hydrolase activity

Sequence:
>Contig4594
TTGGCCAAAAGTCAACGCCTCACACTCTCGCCTTCCTGCGATCATAAACA
TCATCATGTCCGCCGAGCGTCCGCCAGTAACTTGCCACGTCCTCGACACT
TCCGTCGGTAAGCCGGCGGCAAATATCCAGTGCACGTTATCCCGGTTCTT
GAAGTCGGCCGATGGCTCCCCGTCTAGTTCCTGCTTTGAAGTGGCGAAGG
CATCGACCAACGAGGATGGGAGGGTCGCAGCGTGGGAGATGAGGCAGAAG
GGGGTCGCGGGGAAGTTGGTGCTCGAAGAGGGATTCACCTACAAGATTAG
GTTCGAGACTTGGGAGCATTTCAAGGGGGAAACATTCTTTCCGTATGTTG
AGGTGGTGTTTACGGTCAAGGAGATAAACCAGCATTATCATATTCCCCTA
TTGTTGAGTCCTTATGCGTATAGTACGTATCGGGGGTCATGAGTTGGGTT
TCCACGGTAGAAATATTGGGATTTGGTACTGGGAGCAATGCAGGAATAGG
CGGGTGGGTAATGTTTGCTTATACGGTCATATTGGGAGAATAAAGCGCTA
TTTTTACAAAAAGATGATCTGTCTGTGCATGGTAAACGCTACAAGCCAAG
CATAACTCGGATCTTTAAGA

Sequences in the Contig:

SY0AAC26YG14RM1 SY0AAC29YO06FM1 SY0AAC32YG02RM1
SY0AAC33YH13FM1 SY0AAC36YD02FM1 SY0AAC53YE14FM1
SY0AAC9YH16FM1 SY0AAD14YO08FM1 SY0AAD30YO15FM1
SY0AAD43YB06FM1 SY0AAD45YF02FM1 SY0AAD46YD14FM1
SY0AAD50YO10FM1 SY0AAD52YG24FM1 SY0AAD53YK23FM1
SY0AAD55YK24FM1 SY0AAD56YO15FM1 SY0AAD57YG06FM1
SY0AAD58YB03FM1 SY0AAD5YK02FM1 SY0AAD60YN21FM1
SY0AAD62YP12FM1 SY0AAD9YF14FM1