Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4592
Length(NT) : 743
Best Gene Model Blast : Link to GSTUMT00011792001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SNOG_05059
Accession: ref|XP_001795470.1| Score: 716 E_value: 7e-74
KEGG Definition: hypothetical protein
Accession: ncr:NCU08944.1 Score: 666 E_value: 2e-68
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3235 Score: 617 E_value: 6e-65
PFAM Definition: Acetyltransf_1, Acetyltransferase (GNAT) family. This family contains proteins with N-acetyltransferase functions such as Elp3-related proteins..
Pfam Number: pfam00583 Score: 140 E_value: 1e-09
Swissprot: Q9UTI3|ARD1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4592
TTGGCTCATCACCCCGCGTGGACCTCCAGAATTAAGGATTCCCCAACAAA
CGCTCCGTATTACCAATTTTCTCTAACCAGATTTCCCGAACATAAAACTA
GACAACATGGATATCAGAGTTCTCCAACCATCAGATATTCCCCATGTACA
ATTAGCGAACATCACGAATCTTCCAGAAAACTACTTTTGCAAGTACTACC
TCTACCACGCCTTGTCCTGGCCACAACTTTCCTACGTTGCTGTTGACCTC
TCCCACTCCTCTGGCTCGCCCGGCGAACCTCCAAAGATTGTCGGATATGT
TCTCGCAAAGATGGAGGAGGAACCCGCCGACGGAGTTCAGCATGGCCATA
TCACCTCCCTGAGTGTCATGAGGACACATCGCCGACTAGGTCTTGCGGAA
AAATTGATGCGCCAGAGCCAGAAGGCCATGGTTGAAGCATTCGGTGCAAA
ATATGTTTCCCTCCACGTCCGTGTCTCGAACAAAGCCGCGCTACACCTAT
ACCGCGACACATTACAATTTAAAGTCAACAAGGTGGAGGGCAGATATTAC
GCGGATGGAGAGAACGCGTATTCTATGAGGAAGGATTTGACCTTTCTGGA
AGAAGCTGAGAGCGAGAGCGAGAACGAGGGCGAGGAGAAGGTTGAGGATG
TGGGCATTGACGGAGACGTCCCTGAGGGAGGCGAGAAAAAGAAAAAGAAG
AGTAGGGCGAAAAAGTACAAGCTAGGGAGGGCACTTGGGGTTG

Sequences in the Contig:

SY0AAA35YM03FM1 SY0AAB20YN16FM1 SY0AAB33YH08FM1
SY0AAB60YB19FM1 SY0AAC36YC21FM1 SY0AAD43YJ03FM1
SY0AAD50YG20FM1