Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4591
Length(NT) : 3922
Best Gene Model Blast : Link to GSTUMT00010341001 E-value : 0.0
Numbers of ESTs : 34

Blast Results:

Nr Definition: hypothetical protein SS1G_06944
Accession: ref|XP_001591498.1| Score: 544 E_value: 5e-53
KEGG Definition: WD40 domain protein
Accession: afm:AFUA_1G16540 Score: 478 E_value: 1e-45
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4497 Score: 611 E_value: 2e-63
PFAM Definition: No Hit Found
Swissprot: Q9P2S5|WDR8_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig4591
TTGGGCGGAAGACTATGCTCTAGAGTAACCCCCTGCCTCAACCGTCACTA
CCATCATCACGAAGAAGATCCATACCATTCACACCATTCACACCATACCA
TCCATCCACTCACTTATCCACTCATCCAATCCATTCCATCGGAAGAGAAT
TGGGAGTGAGAACATACCACCCCCTCCAACCCCCCCGCGAGGCTACTGCG
CTTCACTCCCTGCCTAGCGAAACGAACCTTCCATCCTTCCCCCTTCCGGA
CTTCCCTCCCTACAAACGCGGTCACACTTCATGGAAGAGTGATGCTTCAG
CACCCTCTCCATATCGCACCTCTTTGCCAAACCTCCTGCCACTCCGCTCC
TGCCACCGTGTTTCTCGGGACGCACCGACTTTTGTCCGGGTCTCTGCTGT
GCTGATTCCTTGCTGACTTTCCTGTCTGCTGTATATCAGGGCAATCCAGG
GAGACTTGCAGGCTTTACAGTAAAAAACCAAACGAGAAAAAAAAGGGAAA
ATAATCTATCTTATTGTCCCAGTGACTTTTTGTGAGCGACGAACCTGCGA
GAGAGAGGGTTGGTAGCCTTCACCTCAACCCAGGAAATCCCGTTATCGCC
CTAAGGGTCATACCCACGAATCTCTGCCCACCAACTCTTCCCTCGCCCAG
CTCATTGCCGTGCCCACAACAAACACTATCACCGCTCCACCCCGCCGCGG
CGCTCCCACTCGCTCACACACTCGTCCACTCATTCTTCAGTTATCACTGG
TGCCTATTCAAGTGTTTGATTGTTTTGTCCATTCTCTCACCGCGCTGCTG
CTTGGCGTTGAAATAAAAAAAGTGCTGCCCTAGAAGAGGAGTGAGGGAAA
TACGGTGGGGAAAAGCCCCCAACTTGAGTCTAATATTGGACTCCGGGGAA
GGTGAGGGTGAAAAAAGCCTCTAAAGGGACCCGCCAGCAAAATAGTGAGC
CTAGCCCACACGGCCCCCATTGGTTCTCCAAACCGAGCAACCCATCCCTT
CCACACACCATCCCTCTCTCAACCTCCCCACTGTCAGTCCGATTCCTACA
TACATCCTCCTCCAAATCGACATTTTTCTCTTTGATCGGGCTCTACCTCT
CTCTCCTACTTTGTTCGAGCCCTGCTAGACTGCATAAACGCACCCAAGTA
TCGAGTCTCAGGGTCCCCGAAAGCCGGAGAAGGAGAGAACTTGCTTTTCC
CCCGAGGCAATAAGCAAGAAGGTCTTGACGTAGGTACCACTAAATCGATC
GGTGGCTGTCCTGTGGTTTCTTCTTTGTTATTCTTGGAATACCCGTTGGT
CTGGGGTTGGTTTTCTCGGTCCATTCTGCCTGCTACTCTACACACCACAC
AAGACTGCAGTAGTGAAGGATCCTGCCTCCCAGGTCCTTAAATTACAACA
TAGTTTGCGGAGAAACACGTTATCGAGCATGGAGTTTTCGACAGAATTTA
GGGGTTCACATTTCACACAACCTTCACCGAATGGGTCGTTAATTGCCTCG
ATCGTGCACCCGAGACTTGTACTCCGTTCAACATCAACGCTACAAGTAAA
ACGAACAATACCACTGAACCCCGACTTTGCGTCTCGAGTGAGTTTCGTCA
AGTGGTCACCTTATTTGAACAGCTCATTCACTTCACCGGCATGGCACGGA
ATTCCTGTAATAGGGAAGAGAAGGAGCGGGGTGGATAAGTCTGAGGAAGA
AGGCGGTGGACGACAGCGTGTATTGCTGGCGGACGACCAATCAATCCAAG
TATATGATGTGGAGGATGAAAAATGGACTGCGGTTATCAAACAGGGCTTT
GGAGGGATCAGGCACCTTCAGTTTGGCAGAAATGCAGACGAAGTTGTTGT
CTTTTCTGAGTTTCAGCTTAAGGTAACCGTTTGGAATTTGGCCACATCAA
AGTTGATAGAGATACTCAATCCAAAATTCCCTACAAGAGGCTACAGTTAT
CGTCCTTGCACTGCTCACTTCGCACTTCTCACTCGTTCATCAACGCATGA
TGTGATAAGTGTCCACCAGCACACAACTTACAAACTCGCGTCAAGTTTTA
CATTGCCAACCCTAGATGCACAAGGCCTTAAGTGGTCACCATGTGGCCGA
TGGATAGCAGTATGGGATTCGGCTGCTTCTGGATACAAAGTTCTTGTATA
CACTGCGGACGGGCATTTATACAGAACGTATGAGAAACCTTGCGAAGGCC
TTGGTGTAAAAAGCGTCGAATGGAGCCCTGGGGGAGACTTTCTAACTATT
GGAAGTTATGATGGGAGATTGGCTTTCCTGAGCAACTACACATTCTCTCC
TGTGATTGAAATGAACCACACGAGGACCGTTAGGCTTCCAGGTGTTACGG
TTTGGTCTGAATGTACAAGCCCACCCCATGGGAGATATTATGCGCAGGCA
CAACAACCAACGACGCTTCCCATAATACCGTCAAGTTCTTCCGACAGTCA
ACTCAAGCTTGGCATCTCAACAATAGCGTTTAATAACCCGGATGGCACAC
TTATTGCTACCAGAAATGATTCTATGCCAACTACCGTTTGGATTTGGTCT
TTGAAACTACTCCGGCCGTACGCCGTCCTTGTTCAACTGAATCCTATCCG
ATCAATTAGCTGGCACCCAACGATTCCGGATCTTCTAATGATTCAGTGTG
CGCCAGGTGGTGATGGGAACTCAGCAGAGCCTTCAAAAGAGCAAGGTGTG
GTATATCTATGGAGTGCGGCTTGGGCCCAGCCAAGGGCGGTGGCTGTACC
AATGGAGCGCCTGTCGGGGAATACTTGGGCGAGATGGATTCTCACCGCTC
CACCCAGTAACACTGTTTCCGCTCCTTTCAGCGCATCGACCACTAGTCCG
GGGCCCCTTATTATGGAAAGGAGGAGTCGGAGTCCCGATAAGATGGAGGA
CAAGAAACCGATGGTTATGTTTGGAGATAGGGATGGTTTTGTTGTGGGGC
ATGTGCAGGATGAGCCGGAGTCGGAGGATGCAGGGAGATCGGTGGACGGG
GTTGAGGTGGAGTGTCAACAGAAGAGGCAGTGGGATCTCGCTGACTGGGA
GTGCTTTGCGCAAGCCGAAAGGCTTCCGAAATGTTCGTTATCATCGGTAC
CCCAGGCGCCTCCGCACTCAAACCCTGGCAACAACAAGGGTTTAAGGGGG
GGGTTGGGAAGTGTTGTTAATAGTTCCTCGGGATCTAACGGATTATCTCC
TCCGGGTGCCAAGGAGGGGGACGATAGTTTTGATTATCGTTCGTGGGGGC
AGAATGTTCGAGTAAGCTCCTAAGCAGGACGATGCGGACGGAACCGGTAG
CTGGGAAATATGAACAATTGGTCCTTCAATACGGTAATAGCTTTCTAACC
GCATTTCGCATTTGATTCCTTGATGAGATACTCTAGGAGAGCTTTGATTA
ATACATTGTTTCTTGTATTTGATTTTTCTTAATTCTTCGCAGGATTCTCC
CCCCCCTTTTTTCTCTTTCCTTACAAATTGTTGTATAATGTGCTTTGATA
TATGGTGTTTTCAGGTGCAAAGTGTTTTTTGTTTTCTCAGACCATTTTCC
TTTCCTGTTCAAATGTGTATTTTGCAGATTTTCTTTCTCATTTGTCCTCA
CTTTTCACTTTTAACCTTTCTCTTCAGCCTACGTTTCTTCATTATAGCCA
TCATCGTCATTATCATCATCAATTTTTCCTTTCCGTTTCTGCTTCTGCTT
TGTTATTGATGATTAGGGTCGTCTTATCCGTTTAACTTTGTTTTAAAAAG
GGAGGGAAAGGCCATTTATCTACGCTTATTTATTTATCTTTTCATCCCAT
CATTCCATCATTGCCATAATTGTTGTCATGGTTCAACTGTTTTACTGATT
CATCATCACACCATTTGACCCCTCGTTCGAACTTGAGCTTGTGTGGAGGG
AAGCGAAGGGATGGAAAGCGTG

Sequences in the Contig:

SY0AAA32YB09FM1 SY0AAA32YB09RM1 SY0AAA32YE07FM1
SY0AAA32YE07RM1 SY0AAA34YM01FM1 SY0AAA37YP16FM1
SY0AAA57YH13FM1 SY0AAA60YN01FM1 SY0AAA8YL08FM1
SY0AAB14YK04FM1 SY0AAB19YJ12FM1 SY0AAB26YI08FM1
SY0AAB2YP02FM1 SY0AAB32YA03FM1 SY0AAB35YF19FM1
SY0AAB40YB23FM1 SY0AAB47YL21FM1 SY0AAB52YG03FM1
SY0AAB53YC15FM1 SY0AAB54YC15FM1 SY0AAC36YC18FM1
SY0AAC3YJ07FM1 SY0AAC41YC24FM1 SY0AAC42YC24FM1
SY0AAC47YD22FM1 SY0AAC47YL13FM1 SY0AAC60YK06FM1
SY0AAD14YB15FM1 SY0AAD15YB15FM1 SY0AAD31YI13FM1
SY0AAD47YB02FM1 SY0AAD55YF22FM1 SY0AAD6YI21FM1
SY0AAD7YI21FM1