Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4590
Length(NT) : 1112
Best Gene Model Blast : Link to GSTUMT00002933001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_14068
Accession: ref|XP_001547478.1| Score: 1141 E_value: 1e-126
KEGG Definition: C-4 sterol methyl oxidase [EC:1.14.13.72]; K07750 methylsterol monooxygenase
Accession: aor:AO090206000001 Score: 1108 E_value: 1e-124
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0873 Score: 916 E_value: 2e-99
PFAM Definition: FA_hydroxylase, Fatty acid hydroxylase superfamily. This superfamily includes fatty acid and carotene hydroxylases and sterol desaturases. Beta-carotene hydroxylase is involved in zeaxanthin synthesis by hydroxylating beta-carotene, but the enzyme may be involved in other pathways. This family includes C-5 sterol desaturase and C-4 sterol methyl oxidase. Members of this family are involved in cholesterol biosynthesis and biosynthesis a plant cuticular wax. These enzymes contain two copies of a HXHH motif. Members of this family are integral membrane proteins..
Pfam Number: pfam04116 Score: 271 E_value: 1e-24
Swissprot: O59933|ERG25_CANAL
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0000254 = Molecular function: C-4 methylsterol oxidase activity

Sequence:
>Contig4590
TTGGTTCACAACCTGCTGGCCAAAGCCTCTCTTTTGCTGGTCACGGCCAT
GTGAGTAGGCAATTCCTCCCTCCCATTATTACCCTTTCTAATTCCGCTTG
CTACAGGTCGAACTTCACCACAATACTCCCGGATTCAGGTGCCTATTGGG
CTGCTTATCACAAGATTTCAGAAGTGAACCTTCATTTAAATATCTTGGAA
CGTCTTTGGGCGGCGTGTTAGTTCTTCTGCCCTTTTGTTGGATGCATTTA
TTTATACCGCTCCCAGGGTACCAATACATGGAAAATGATACCCTCGCTAC
TGGCATCATGTCGTTCGTCATGCACGAAGTTGTTTACTTTGGCCGCTCAC
TCCCATGGATGATTATTGATAGGATTCCTTGGTTCCGAAGATACAAAATT
CAAAACACCAAGATTCCAACCGCAGCAGAGCAATGGAGATGCGCAAAGCT
GGTTCTTCTATCTCACTTCACTGTCGAGCTTCCTCAGATCTGGCTTTTCC
ACCCCATGTGCAAGTACTTCGGTATGGATACGGATGTTCCTTTCCCACCA
TGGACAAAGATTGCCTTTCAAGTCGCCATTTTCTTTGTTCTGGAGGATAC
CTGGCACTATTGGTCCCATCGTGCTTTCCACTGGGGCCCACTTTATAAAC
ACGTCCACAAGATTCATCACACATACGCGGCACCCTTCGGCCTTGCCGCC
GAGTACGCTTCCCCTATCGAGGTTATGGCTCTTGGTTTTGGGACTGTCGG
TATGCCAATGGTATGGTGCATGGTTACCAAAGATCTTCATATTCTCACGG
TCTATATCTGGATTGTTCTTCGGCTCTTCCAAGCCATTGATGCCCATTCT
GGTTACGAATTCCCCTGGAGTTTGCACCACTTCCTTCCTTTCTGGGCCGG
CGCCGAACACCACGATGTTCACCACGAAAAGTTCATTGGCAATTATGCGA
GTTCTTTTAGGTGGTGGGATTACCTTCTCGATACCGAGGCTGGTCCGGAG
GCTGCTAAGAAGAGGCGTGAGAAGAAGCTGGCCAAGGAAACTGCTAAAGC
TAGAAAGGCTCTGTAGGCTGGTTACAAGCATTATCTGTTGTCGCGGTGGG
GTTTTTGGGAGC

Sequences in the Contig:

SY0AAA40YD02FM1 SY0AAC34YP22FM1 SY0AAC36YC06FM1
SY0AAD44YI10FM1 SY0AAD62YE18FM1