Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig459
Length(NT) : 851
Best Gene Model Blast : Link to GSTUMT00000908001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 624 E_value: 4e-63
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 575 E_value: 9e-58
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 318 E_value: 3e-30
PFAM Definition: No Hit Found
Swissprot: Q99NH0|ANR17_MOUSE
Gene Ontology:
GO:0007492 = Biological process: endoderm development

Sequence:
>Contig459
TTGGGGGGAAGAGGGGCACGAGGGGGTCGTGAAGTTGTTATTGCAAAGGA
AGGATGTTAAACCCGATGCGGCAGACGGATACGGCCGGACGCCTCTATTC
TGTGCTTCCAGCAAGGGGCGCGAGGGAGCAGTGAGGCTGCTATTGGAATG
CGAAAAAGTCAGCATTGATAGGGCTGACACCTATGGTGAAACGCTACTCC
TGTCGGCTGCTGAGGGCGGGTATGACGGAGTGGTGAGCCTACTACTGGGA
AGGAAAGATATCAACCCCAACACGCCGTGCGGCGCCGGCCAGACACCAAT
CTTGCTTGCTTCTGGGAAAGGACATGATGGGGTAGTGAAGCTACTTCTGG
GGCGGGAAGACATAAACCCTGATTTCCCCGACAACCACGGCAAAACTCCT
CTTTCCTGGGGTGCCACGAATGGGCGTGATGAAGTGGTGAAACTGCTGTT
GGGACGGAGAGACATTAAACCAGATTTCCGTGACAATTATGGCAAAACGC
CGCTCTTGTGGGCTGCCGAGCGCGGCCATAGTAGAGTGGTAAAGCTGCTA
TTAGCACGGGGAGACGTCAACCCCGACATGCCAGACGAGCTTGGCAAAAC
ACCGCTCTCGTGGGCTGCCGAGCGTGGGCACGGTGAAGTAGTGAAGTTAC
TGTTGAGGCGGAAAGACGTCTACCCTGATATACCAGACAACCGTGGCAAA
ACACCGCTATTGTGGGCTGCGGCTGATGGGCGTGACGTAGTGGTGAAGCT
ACTCTTGGGACGGAACGACGTCAACCCTGATGCGCGAGACAACCGCGGAA
AAACACCGCTCTCGTGGGCTGCCGGAAAGGGGCATTGTGGGGTAGTGAGG
C

Sequences in the Contig:

SY0AAA24YG22FM1 SY0AAA24YG22FM2 SY0AAA62YM05FM1
SY0AAC62YM10FM1