Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4588
Length(NT) : 2141
Best Gene Model Blast : Link to GSTUMT00004439001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein HCAG_08703
Accession: ref|XP_001536382.1| Score: 549 E_value: 2e-96
KEGG Definition: hypothetical protein [EC:2.7.12.1]; K08825 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase
Accession: mgr:MGG_06399 Score: 531 E_value: 5e-95
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0667 Score: 263 E_value: 2e-23
PFAM Definition: GAL11, Transcription regulatory protein GAL11. This family contains yeast GAL11 proteins. Gal11 and Sin4 proteins are yeast global transcription factors that regulate transcription of a variety of genes, both positively and negatively. Gal11, in a major part, functions in the activation of transcription, whereas Sin4 has an opposite role, yet they are reported to be present as a complex in the so-called RNA polymerase II holoenzyme..
Pfam Number: pfam05397 Score: 140 E_value: 4e-09
Swissprot: P14680|YAK1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004672 = Molecular function: protein kinase activity
GO:0006468 = Biological process: protein amino acid phosphorylation

Sequence:
>Contig4588
TAATGCCAACTTTGTACAAAAAAGTTGGTAGATTTTGGCTCCGCATGTGA
TGAGAGACAGACAGTTTATACCTATATCCAATCCCGTTTCTATCGATCAC
CCGAAGTTTTGTTAGGATTACCGTAAGTGAATTCTTTACCTTGAAGTATG
TGGGTTAACGCTATGCAGGTACTCCTCGTCAATTGATATGTGGTCGCTTG
GGTGTATTGTCGTAGAGTTATTCTTGGGTCTCCCACTCTTCCCGGGTAGC
TCTGAGTACAATCAGGTAGCGAGAATCAATGAAATGCTTGGAATGCCCCC
TGTCTGGATGCTCGAGATGGGAAAACAAGCCGGCGAATTCTTTGAGAAGG
TACATGATGAGTTTGGGAGGAAGATTTACCAGCTCAAGAGCATGGAGAAA
TACTCCCGAGAACACGGGACGAAGGAGCAACCTAGCAAGAAATACTTCCA
GGCAACCACATTGCCTGAGATAATCCGCCAGTATGCGATGCCTCGAAAAA
ATATGAAACCAATTGAGATCGAGAGAGGTGTGTTTCGTCCAGTGCTTCCG
TGGTATGGACGCTCTAACATGGGTTGATATAGAAATGAACAATCGAATCG
CCTTTATTGACTTCGTTCGGGGTTTACTAAATATCAATCCTGTAGAACGA
TGGTCCCCACAACAAGCAAAGCTACACCCCTTCATTACCCAACAGAAGTA
CACGGGACCTTTCGTACCTCCTATGAATCTTAAATCACCACCACCGAAGT
CCCCAATGTCTGGCGCTGAACAGCAGAGAGCAGAGCAAGCAATGATGCAA
AAGCAACAAGCAGCGATGCAGGCACAGGCCCAGATTCAAGCCCAGCAGCG
CGCTCAACAGGCTCAGCAAGCTGCCCATGTGGCTCAGTCACAACCCAATT
ATTCTGCTGTCTCTCTTGGCAATTTCCCAGCCTCCTCAGGACATCCACAA
CCTCCCACGGTCTACAATAATGCTTACAGCTCGACACAGCAGCCCAACCA
GCCCCAGCAGCAAGCCCCACCAGCTTATACAACGAGCAGTACCCAATATG
GGAGTCAACTTGGTATCATGCAACAGCAGCAACAGCAGCAGCAGCACCAA
CACCAGCATCAAGGAGGGCAAGTCTCTTCAGGCTATGGTCAGGCTTCCCA
TCAAGCACTCTATTCCCAGAACCCCAATCGGGCGGCTCGCCAGCGCTCAG
CCACGATGGTGGATGGAGTCCCTCCCCAAATCCAAAGAGCTGCCTCAATG
ATGGATCCTACACAACCTATCCGTCTGCAACCCAGCCCAGCATATTTCCC
GCCTCCGCCCGGAGGCATTCCAGACGAACCTGGTAATGGGAGGGGACGGC
AACAGGCCCGTGGAGGACAGTATAGGAACCGCAATGTGATAAGGACTTTG
GAAGGTAACTTGGAGGATGGGCTTCTCAGTCAACAGCATTGGGGGTAATT
CGATCGGCTCGGTAGCGCCTCTCCTGGTTTCATTTGTTACTATCGGCTCT
GTTGGTTGTCTTGTGGGTGGTTTGTGAATTTGTTTTGCATGCGTAAGCGT
CCGGCTTTTTCTCCGCCTAGCCGTGGGCGTATGGATGGCGAGTTCACAAC
AAGAGAACGCTCTGGATTCACATTAAAAAAGTGCCCCCATATTGGAAAAA
ACAGGAATGGGGCAACCACACGTATCCGAATGGATGGGGATTAATGGAGG
TGAAAGTGAATCGGGGGAGAGAGTGTGGAAACATCATTTGTAAAAGGGGC
CTCATTGGTTCCCTCAAAAGCTAGTTTTTTCCTTTTATATTTACGATTAT
CCTATGCTCACGACTAACTAGTTTCTCGTTGCATTGTTTCATGTTTTTTT
TTGTTTTCCAGTTTTAACGAATTTGAGGAGGCCTTTCCCTTCTTCCCCCT
TTCCCTTCCCTTCTTCCCCTTCCTTTCTAGCTGCTGAAAACGGATTGTTT
TGGATTGAGTGGGTGGCTTGTGGCCGAGGTGCTTGAGTTGTTGCGAGTGA
TTATTTGTGAGTTGAGATAGTGATGTTGTGCAATGACCGCAGTGCTGTCC
ACGGTTGTTACGAAGGCGTTGTACGATAAGCGGTTTCCAGCTTTTACTTT
TTCTTTCTCTCTTTTCTTTTTTCTTCTTCCCCTATCGGTCT

Sequences in the Contig:

SY0AAA33YE09FM1 SY0AAB28YE18FM1 SY0AAB58YI16FM1
SY0AAC25YD07FM1 SY0AAC35YE06FM1 SY0AAC36YB24FM1
SY0AAD57YK20FM1