Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4587
Length(NT) : 880
Best Gene Model Blast : Link to GSTUMT00006816001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 117 E_value: 6e-07
PFAM Definition: No Hit Found

Sequence:
>Contig4587
TTGGGCAAGACATTACCTTCCGCTGCGATTGGGCCTGACAGGACCAAAGC
GCACGACGCGGCAAACGGGGGACGCGGAGCGACTCATGGTACGCATGCGC
TCGCTGGAGCGCGGCGCCGCTAGCTTCCCAAGCCTGAGCGTCTTCGCCCT
CGCAATCCTGGCGTTCAAAGACACGTGCATCTCCTCTACCACCCTCCTCA
TCGACATGTTGTACACCCTCCACCGTCTCCATCGATACGCCGAAATCCCC
CCACTCCTAGCCTCCCTAAAATTCTACAACATCTCGCCCCCGCGCTCCGA
TATCGCACGGCTAATCCGCCTACTGACGAGAGCCCATCCAACCTCCGCAC
TAGAACTCCTCCAGATATACCCAGACACCCAATACTCCGTTTTCGCACAA
TTCATCGTGCGGACCGCAACCCTGCACCCGGACCTCGCGCTGCGGGCATA
CCAACTCCTGACACCGCCAACACTGCACTACTTCTCGCGCTTCCAGCCGA
AGATCCCGGGCCGCAGGCTTCCCGGCAGGAAGCTGCTAGTCGCGATGGGG
TGGAACTTTGCGAATTCACCGGTTCTATCGCCGAGGCAGTGTCTTCGCTA
CGCGCAGAGGTGCTTGAGGGCGATGTTGGTGCTGGGATTTGATCCTGGGC
CGAGGATGGGGTGGGCTATTGCCGTCGCCGGTGTCGAGAGGGCGATCCAC
GCGGAGATTCCGGTGAGGAGGGAATGGGAGCGGATGAAGTGGGTGCTGGA
GACTGTCAGGAGGAATGCAGGGCCCAAGAGGGCGAGGGAGGTAGATCTTA
TATTGAGCAGATGGGAGAAGAATGTTTGGAATGGTAGTGTAAGTAGGAGG
GGGGGGCAGTGATTGCCGGTGTATATGATC

Sequences in the Contig:

SY0AAC36YB21FM1 SY0AAC42YI23FM1 SY0AAD61YH12FM1