Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4586
Length(NT) : 682
Best Gene Model Blast : Link to GSTUMT00003070001 E-value : 1e-180
Numbers of ESTs : 2

Blast Results:

Nr Definition: ATP-dependent RNA helicase DHX8
Accession: ref|XP_001543915.1| Score: 342 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: ani:AN4721.2 Score: 325 E_value: 6e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O42643|PRP22_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4586
TTGGGGAAAACATGGAAGCCCTCGAAGACCTCCAGAACCTGGGAGTACCT
TTCCCTGGTTTCCAAGATCACCACAGAGCTGGGCAACCACTTGGGCATCG
ACGACAAGACGCTCGCGGAATTTGTCATAAACCTGCACCAGCAAACCAGC
TCCCCCGAGGAGTTCAAGAAGATAATTGCCTCACATGGCGTCGACTTCCC
GGACTCCCTCATTACTAGCATCGATAGGTTGGTGCTCACAATGCACCCGA
AGCACAAGAACAAACGGTCAAAAGGATCTGGTGATGGGAGCGAAGAAGGG
ACGAAGAAGGAAATGGACTTGGATACCAAGGCTAGGGTGTTCAAGGGTTT
GGCTTTGCCGGATAAGGAGGTGCCGCCCACGTGGGAAGAGGATTACGGGG
AGGGCGGGAAGAAGAATAAGGAGCCAAATGCAATAGATGATATGATGGCG
ATGCTGGAGAATTTGGAGTCGAAGAGCAAGTCGGAGAATAGAAAGAAGGA
GGGCGGGGGTGGCGACGCGTTGGCGTTTTTGGAAAGATTGGAGCCAGGAA
GAGAGCGGGGTGTGGGAGAACGCTCTAGGAAACGGAGTCGCTCGCCGAGT
CCGTATGGTAGGCTCGCGCGGAACTACAGGTCTAGGTCAGGGTCAAGGTC
TAGAGGGGGGGATAGGAAGAGGGGTCGCGAAC

Sequences in the Contig:

SY0AAA23YB02FM1 SY0AAC36YB18FM1