Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4584
Length(NT) : 1650
Best Gene Model Blast : Link to GSTUMT00004111001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_12752
Accession: ref|XP_001586177.1| Score: 1207 E_value: 1e-130
KEGG Definition: hypothetical protein
Accession: ncr:NCU08118.1 Score: 1196 E_value: 1e-129
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0735 Score: 1170 E_value: 1e-128
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 486 E_value: 2e-49
Swissprot: P46463|PEX1_PICPA

Sequence:
>Contig4584
TTGGGCCATGATAGAGGAGGATAAGACTTCGGTCTCCCCTGGGGAAAGTG
TGCTTGAGGGTGCTCTGACTGACGGACTCATTCTCCCGGCAATTCGGGAC
TCGCCGATTGCTGCCGGTGGCGTCCTCAAAATTGAGGTCTCTGCTGGTGA
GGGTGGGGAGGCGCCCCAGTATATTAAATGGGTTCTGGTGGCGGACAAAA
AGCCCCCACTCGAGATCGGGTCACTTGTACCCAAGCCTACTCCTCCACCA
GCGGTCGTTTCGGAGACGTTGTTCGTCCCGGGAACTGATTCCGATCAGCC
GATTGTGGGTGTTGACGACATCCTTTCCTCAGTCACCGACCATTTGCTAT
CTTCTTCCTCAGTATTGCTCTCAGGTGCTCACGGATCGGGAAAGACTTCA
ATCCTCCGCCTCATCGCAAAGCGTCTCTCTGGAGCTCCACATTTCCACAG
GATCATAGACCCCGGCTCTCTTTCGAAGCTTTCCGAAGAGCGTGTAGGCA
CAGTTAAAGAGAATGTCTCCCGCTGGTTCACCGAGGCCATATGGGCAGCC
GGGAAGACAGGCCACTCCATCCTTCTCCTCGATGACCTCGACAGACTATG
TGCCTCTGAGTCGGAAAATCAAGACAATTCTCGAGTGAGGCAGATCGCTG
AAGTCGTCGTGGCCGCCGTCAGGAAATACACCTCACCTGGCGGTGCCGGT
GGACGCGGAGGTGTGATTATCCTAGCTAGTTGTCAGGCAAAGGAAAGCAT
GCATAGCCTGGTAGTCAGCGGTCACGTATTCCGCGAAGCACTCTCTCTCA
AAGCAATGTCGAAGGAGGGTCGTCGTGCAGTACTAGACGGCGTTGTCGGG
GCCACTTCGGGAGTCTTAGAGAAAGGTCTTGAACTCCGCGACATTGCCTC
TAAAACAGAGGGCTATATGCCCGGGGACTTGGTCCTCCTCGTCGGCCGTG
CTAGACATGAAGCTGTCGTCCGCATGGTCGACGCAGGCGAATCTAAAGAA
TCCCCAATACTAACCCTCAGGCGTATAGACTTCGACTCTGCTCTCCGAGG
ATTCGTCCCCGCTGGGCTCCGGGGTGTAAAGCTACAAACCTCCGGCTCGA
GCTGGAAAGATATCGGCGGTTTAACAGAAACCCGCAGAATCCTCCTAGAA
ACGCTCGAATGGCCCACCAAATATGCCCCTATATTTGCTAGCTGCCCCTT
ACGCCTCCGCAGCGGCCTCCTTCTCTATGGCTATCCCGGGTGCGGAAAAA
CCCTTCTAGCAAGCGCAGTAGCCGGAGAATGCGGCCTCAATTTCATTTCT
GTCAAAGGCCCCGAAATCCTTAACAAGTACATCGGAGCTTCAGAAAAGTC
CGTCCGTGACCTCTTCGAGCGCGCCAGCGGCGCAAAGCCCTGCGTCTTAT
TCTTTGACGAATTTGACAGTATTGCACCGAAACGTGGTCACGATTCTACC
GGGGTCACTGATCGTGTGGTAAATCAAATGCTTACACAGATGGATGGTGC
GGAAGGACTCGACGGCGTGTACGTCCTCGCAGCAACCTCTCGACCGGACC
TAATCGACCCTGCGCTCCTCCGCCCTGGCCGTTTGGACAAGAGCTTGCTG
TGTGACTTGCCAAATCTCGAAGACCGGCTAGATATCTTCCGCGCGCTCGT

Sequences in the Contig:

SY0AAC36YB02FM1 SY0AAC41YL20FM1 SY0AAD13YB14FM1
SY0AAD31YL22FM1