Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4583
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00007052001 E-value : 1e-121
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_02202
Accession: ref|XP_001595986.1| Score: 638 E_value: 6e-65
KEGG Definition: hypothetical protein
Accession: ang:An11g02620 Score: 568 E_value: 4e-57
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0258 Score: 666 E_value: 1e-70
PFAM Definition: No Hit Found
Swissprot: P52893|ALAM_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig4583
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGTTGAAGCCTAGAAGTCAA
GTCGCCTCCGCAAGCAGTCTTAAATATGTCTACTTCATCTCCTCGCAAAG
CTTTAAACATCAAGAACATCAACCCTCACATCCTCAAAGCTCAGTATGCC
GTCCGTGGCGAGCTTGCCCAACGTTCCGAAGTGTGCCGCCAACAACTTGC
TGCCGGCGACGCCAAACTACCTTTCGATTCTGTCATTTCAGCAAACATTG
GAAACCCGCAGCAGCTGGGCCAAAAACCCATTACCTTTTTCCGTCAGGTT
CTGAGTATACTAGAGTACCCGGCCCTGTTGGAGAAGGAAGGATTATTCCC
TGAGGATGTTCGAGAGAGAGCGAGGGTTCTCCTGAAGGAGGTGGGAAGCG
TTGGCGCTTATTCTCAGAGTCAAGGATGTTTGGGAATTAGGCGGAGCGTT
GCAAAGTTTATTGAAGCTCGTGACGGACACCCCGCGGACCCTCGCGATAT
CTTCTTGACAGCCGGAGCCTCCTCTGGGGTCAACACCCTTTTAAACACCA
TCTGCTCGCATCCCGCCACCGGGGTGTTGATTCCAATCCCCCAATATCCG
CTTTACACCGCTACTCTTGCTCTCCTCAACGCCACTCCGGTCCCTTATTT
TTTGGAC

Sequences in the Contig:

SY0AAC36YA20FM1 SY0AAC52YA10FM1 SY0AAC52YP07FM1
SY0AAD19YG10FM1 SY0AAD19YN03FM1