Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4582
Length(NT) : 1637
Best Gene Model Blast : Link to GSTUMT00005369001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: clathrin heavy chain
Accession: ref|XP_752055.1| Score: 1418 E_value: 0.0
KEGG Definition: clathrin heavy chain; K04646 clathrin, heavy polypeptide
Accession: afm:AFUA_4G07700 Score: 1418 E_value: 0.0
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0985 Score: 1604 E_value: 1e-179
PFAM Definition: Clathrin, Region in Clathrin and VPS. Each region is about 140 amino acids long. The regions are composed of multiple alpha helical repeats. They occur in the arm region of the Clathrin heavy chain..
Pfam Number: pfam00637 Score: 293 E_value: 5e-27
Swissprot: Q10161|CLH_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0006886 = Biological process: intracellular protein transport

Sequence:
>Contig4582
TTGGGAGCTTCAAAACATTTGAGGGTCTCTACTATTACCTTGGCAGTATC
GTCAATTTGAGCGAAGATCCGGATGTGCACTTCAAGTACATCCAAGCGGC
CACTGTTTGCGGTCAGATGAGTGAGGTAGAGCGGATCTGTCGCGATAGCA
ATTTCTACAATCCGGAGAAGGTCAAGAATTTTCTTAAGGAGGCAAAGCTG
ACTGAACAACTTCCATTGATTGTGGTCTGCGATCGTTTCAATTTTATCCA
CGAGCTGGTATTATACCTCTACCAGAACCAGCAGTTCAAGTCTATTGAGG
TCTACGTCCAGAGAGTTAATCCGGCTAGAACTCCAGCAGTGGTTGGAGGA
CTCTTGGATGTTGACTGCGAGGAGTCCATCATTAAGAATCTGTTGAAATC
TGTCCAGAGCTCGGCAATTCCTATCGACGAGCTTGTTGCCGAAGTTGAGC
GTAGGAACCGTCTAAAACTTTTGTTGCCCTTTTTGGAGGATACATTGGCA
GCCGGAAATCAACAACCAGCTGTCTACAATGCCCTTGCAAAGATATACAT
CGATAGTAACAACAACCCGGAGAAATTCTTGAAAGAGAACAACCAGTACG
ACAATTTGGTAGTCGGAAAGTACTGCGAAAAGAGAGACCCATACTTGGCA
TTCATTGCATACCAGAAGGGTCAGAATGATGTTGAATTGGTTAGAATTAC
CAATGAGAACTCAATGTTCAAGCAGCAGGCCCGGTACCTTGTAGCACGCC
GTGATTCCGAACTGTGGGGCTTTGTCTTGAGCCCCAATAACATCCACCGC
CGTTCTCTAGTGGACCAAGTTGTCGCAACTGCCGTCCCCGAATCCACTGA
CCCCGAGGATGTTTCAGTGGCTGTGCAGTGCTTCTTGAGCAACGACCTCC
CGACCGAGTTGATCGAGCTTCTTGAGAAGATTATTCTTGAGCCATCCACA
TTCAGTGATAACAGCAGCCTACAGAACCTGCTTATCCTCACGGCAGTTAA
AGCGGATAAGGCCCGCGTAATGGACTACATTCACCGTCTCACGAATTACG
ACGGCCCCGATGTAGCTCACATTGCCATCCAGAATGGGACTCTACGAGGA
GGCATTTGAGGTCTACAAAAAGATAAATGCACACAGTGACGCTATCAACG
TTCTCATTGAAAACATAGTTAGCATTGAACGCGCCTTTGGCTATGCTGAT
CGTGTTGATTTGCCCGAGGTATGGAGTCGTCTCGGTAAGGCTCAGTTGGA
CGGCCTTCGTATTACCGATTCTATCGAATCTTATATCCGAGCTAAGGACC
CTGGCAACTATGCGGAGGTTATCGAGATAGCTACTCATGCTGCAAAGTTC
GAGGATCTCATCAAATATCTTCAAATGTGCAGACAGACCCTGAGAGAGCC
AGCTGTTGATAGTAGCTTGGTTCTGTGTTATGCTAGGGTTGATAAATTGC
CTGAGCTGGAGGAGTTCCTAAATAGCTCGAACGTTGCCAATATCGAGGAG
TGTGGTGACAAGGCATACGAAGAGGGGCTTCACCAGGCCGCCAAAGTCTT
CTTCTCGAGCATTTCCAACTGGGCCAAATTGGCTACTACTCTCGTATTCT
TGGAAGAGTACCAAAATGCTGTCGAGTGCGCCCGTAA

Sequences in the Contig:

SY0AAA36YI01FM1 SY0AAA6YA13FM1 SY0AAC36YA17FM1
SY0AAC50YI13FM1 SY0AAC57YF14FM1