Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4581
Length(NT) : 877
Best Gene Model Blast : Link to GSTUMT00007634001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 110 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4581
TTGGCGAGAATATTTATAAGTTTGTTGAGGGCGGAAAGGTTGGATACCCG
GTTAGACCAGCCTTCCAAGAGCCCGTGGGATGCTGCCTGATTGTCTCCCA
TTCCCTGCATTTCGACACTCACAACCACGACATCAACTACTCTCTTCGCT
TGCCTTTTGGTTGTCTCTTCCTCCCCATTCTTCCCTATTTCTTACGCATT
TGAACTGTTCACCTGCCTCCATGGCTAAGGGTGAGAAGAAGGATCTCCCC
CCTTCTCCTAAGCTTGCTGCCTCGCCTCCAGATCCTCCTTCACCAGCTAC
CGGTATCTCGACTGTTCACGCTTCTGGTGTTCCGTCGTCATTGCCACCAA
GCGAGTCCAATCTTCGCTCTACATCGCAGGTATCATTAGTGTCCACTGAT
GTCACACCCCCTCCTCCCACTCAGTCATTCTCAAGCATGGAGCCGAAGAT
GACTGGAGGCTGCGTACCCCGTAAATCCAGTTACGCTGAATCACTGAAAG
TGAGCTCCAAGGGTTGGTTTTCGCGAACAGGTACCTGGTCTCGATCTGGT
GGGACAAAATCCGCTGCTATAACAAAGGTAGCTTCTGAAAACGTGTCGAG
GGAGCCAAGCATTGCTGGCGGGCCAAACAAAACGGAGGGAACAAGTGGGC
TTGTGCCCGATGTTGGACCGCTTGAACCTTTACCATCTACAACAGGGCAA
GCATCGGAACTCCCGCGGGAATCCACCCCTCCGCCGTCGCTCGAAGAGCC
CTTGGCTCCTCCAGCTATTCCTACCAGTCTCAGTACCACTACTCTTCCAA
CTGCGGAGCCCTTTGAGGCTCAGCCGGAAGCGCGGCTGCCACTGTCTATG
GAGCCCCTGAACAGTGCTAGTGATTCA

Sequences in the Contig:

SY0AAA50YC05FM1 SY0AAC36YA16FM1 SY0AAC51YD18FM1