Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4580
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00005396001 E-value : 1e-81
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4580
TACTAGTACGAGTACATGCAAATATGCCACAGCAAACAAGTCAGCAGACC
AGGGAGAACCAAAAAGACCTTTTCGTTTCATAGCAACTTATGGTGGGGTC
GCTATATGCTACGAGTACTTTCTTTTTTCTTTTTTTTTACCCTCCCCTCA
ACTCCCCCTTCTTCCCCCACCGATAACATACCCTTTGGTGTAATCTCAAA
GTACGGTAAAGCGAAGTCAAGGTGTCAAGAAATCATCATCGAAGAGGAAA
AAAAAAAGAAAAAACCTCCCGCCTATTTATCATTGTATCAAGGGAGAAGG
TTTTTAAAACAATAAAATAAAAACGCACAAATCCCCCTCCCAGCCCCGCC
CCAGGTTCAATGACAGATATCTCCCACACCCGGGCATACGTGTCGTCTAC
CTGCCCTCTTTTGCGTGGCCCAATTCCAATTCCAGTTACCAATATCTCCA
ATATCTCCAATGAGCAAAGAAAGCGAGAAGGTGTATACCGCAAAATGGGA
TGAGAAGAGTGAAAGGGTCATTACAACGTTGTCATAATTAAATATCTAGG
AAGAGGGGAACGAACGCTGCATGACATAAAAGGAAATATAAAAATCATCG
TCGCTGCTGCGTACTCGTACTATCCGATTCATCGTCCTTCACCAATCTG

Sequences in the Contig:

SY0AAA21YE08RM1 SY0AAC36YA03FM1