Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4579
Length(NT) : 1497
Best Gene Model Blast : Link to GSTUMT00010466001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: long-chain fatty acid transporter
Accession: ref|XP_750620.1| Score: 956 E_value: 1e-101
KEGG Definition: long-chain fatty acid transporter, putative
Accession: afm:AFUA_6G07270 Score: 956 E_value: 1e-101
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1179 Score: 766 E_value: 6e-82
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 404 E_value: 7e-40
Swissprot: O42633|FAT1_COCHE

Sequence:
>Contig4579
TTGGCACTCGAACTCTTTCCCCTCCCCTTACCCTCCCCTCCCTCCACCTT
CTTCCCATCCTCCTCCATCCTCCCTCATCCCCCCTCATCCGCCCTCCTTC
TCCCGTATCCCCTCACCCTAATTACTCAGCTCTTACTGTTTGCCTTATCA
TACATACCAATTCGTGCCTCCCATAAGTAGGGTAGATATAGACACATACA
CACCTCAACAAACATCCTACTTTGCCACTTTCTCCTGCCACTACCGTAGC
AGCAGCAAACAAGCAAACAAATAATGGCTCCGCCACTGGCTCTGCTGGCA
GCGGCTCTGCCGCTGCTCTCCTACCTGGATGCGAAGCACCAGTTGACATA
CGATTACGCGGTGATCTCCTCGTTTTTGTATTCCCGCATCCGGTGTCTGC
TCCTGGAGCGCCGCGGGCGATTGAATCCCTTCTACGGTCTCGAGAAGCGT
GCCCTCTCACCCACCGACTGTGAACGTCTGTTCCTAATCTACCAAGGCCG
CGAATACTCATACAAGGAAGCCTACGAATTAGCGCTCAAGTATGCTGCCT
GGCTGCGTGAACGGTACAACGTCCAGAGGAATGAGATCATCGCGATTGAT
TTTATGAACAAGCCAGCTATGATCTGGATCTGGTTGGGGTTGTGGGCCTT
GGGCGCGAAGCCTGCACTGCTAAATTACAATCTTGAGGGGGATAGGCTCG
TGCATTGTGTCAAGATATCGACGGCTAGGCTCATGTTTGTTGACGTGGAA
GTGAAGGGGGTTCTCGAGGGATCCGAAGGGCAGGAGACGAGGAGGAGGTT
GGAGACTGAGGGAGCGAACCGCGAGGTCGTAATATTTGATGAGGCTGCCG
AGAGGGTTGTGGAGACCTGGAAAGGCTTTCGCCCGGGGGATGAGGAGAGG
ATCGGGGCTAAGCTTTCTGAAATGGCCATGCTAGTCTATACTAGCGGGAC
AACCGGTATGCCCAAAGCCGCCATCGTATCTTTCCAGAAAACCCACTACG
GCTCTGGCTTCGTCAGTGCATGGGTTGAATTAAAAAAATCCGACAGGTTT
TACACCTGCATGCCCTTGTACCATGCTTCTGCCGCACTTCTTGGCTTCGT
CGGTGCTATGATGTCCGGTTTCACGCTTGTCCTCGGACATAGGTTTTCCA
CAAAAACCTTCTGGCCAGAAGTTCGCAGCAGCCGGGCTACTATCCTCCAA
TATGTTGGCGAGACATGTCGTTACCTACTTGCGGCCCCACCTTCCCCGGA
TGACAAAGACCACAATGTGAAAATTGCTTTCGGCAATGGCCTAAGACCGG
ACGTGTGGGTCCGCTTCAAGGAGCGCTTTGGTATTCCTGCCATCGCCGAG
TTCTACGCCAGCACTGAGGGCACGTCTGGATCTTGGAATCTTCAAAGAGG
AGAATGGGGTGTCGGTGCGGTAGGCCGTAGTGGCTCCCTCGTCTCACTAC
TATTAGGCAGTGGGGTTAAGATTGCAAAAATGGACGCCGGAAACGAA

Sequences in the Contig:

SY0AAC24YP24FM1 SY0AAC31YI09FM1 SY0AAC35YP22FM1
SY0AAC41YJ15FM1 SY0AAC43YF18FM1 SY0AAC49YA16FM1
SY0AAD36YA19FM1 SY0AAD63YC13FM1 SY0AAD8YJ17FM1