Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4578
Length(NT) : 867
Best Gene Model Blast : Link to GSTUMT00006868001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CHGG_00888
Accession: ref|XP_001220109.1| Score: 236 E_value: 4e-18
KEGG Definition: hypothetical protein
Accession: ncr:NCU03146.1 Score: 208 E_value: 4e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4578
TTGGGCATAAGTCACGATAGCTTGTACGAGTACTGTACCCTCCGTTTTAA
TCACCTCCGCTCCCTCCTTGTCTTCCACAAGCTTCTCCTCTCTTCGACGA
ACACAATAGCACTAGTACGGCGCCCATGGACGAAGAACTCTCCCGTTTCC
GCCAACAGTGGCAAGCGGAAGTATCCGCCCGCCAACACCAAGCCCCAGGG
TCCTCCATACCCCAACCGAGCAGTTCCGTAAACAAACCAAAACCAAATCC
CTTCGCATCAAGAAAGCTGTCCCATTCCTCCTCTGCCGGCGAGAACGTCG
AAGACGAACCAGAACTCTCAACCCAACGGCCCCCATCGCCAATTGCTCGT
CGACGAACCTCCTTTGCAGGAAGCTCTTCCCGGGCGGATCCTGTGAGTGC
GCTCGAGCATTATGAGCGGGCGGTGGAGAAGGAATCCGAAGGTAGTTTGG
GGGAAAGCTTGAGTTTGTACAGGAAGGCGTTTAGGATGGATCACAAGGTT
GATTCTCACTATCGGGAGAAGCACTTCCCACGACCGCCCCCTTCATTGGC
TAAGAATAGGATACCTCTTGCTACCATTCTTTCTTCCCAGCCATCAGTAC
CCGCCTCAGTCCCGGCTCCGGCTTCGCTAGCTTCTGGTTCGAAGGAGATG
AGCGAGTTGATCGCTTCGTTTGCAGGGGTTCAAATTCAGCCTGTTCCTGT
CGCTGAACTCAATGAAAAGGAAGCAGCTATGGATAAAGGGAAGGGGAAGG
AAACAGAAACGGAAGAGGAAGAAGCAGGGTTTTCCCCGTTAGCAACGCTC
CCTTTCGAGCTCCTGCTCCAGGTTGTCAGAAACGTAGCTTTAACAGACGT
CGCCTCGTTCGCAAGGT

Sequences in the Contig:

SY0AAA28YN04FM1 SY0AAA57YP23FM1 SY0AAC24YI23FM1
SY0AAC35YP17FM1