Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4577
Length(NT) : 2564
Best Gene Model Blast : Link to GSTUMT00005686001 E-value : 0.0
Numbers of ESTs : 31

Blast Results:

Nr Definition: hypothetical protein SNOG_14664
Accession: ref|XP_001804847.1| Score: 1229 E_value: 1e-132
KEGG Definition: hypothetical protein
Accession: ncr:NCU00170.1 Score: 1200 E_value: 1e-129
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0550 Score: 814 E_value: 4e-87
PFAM Definition: DnaJ, DnaJ domain. DnaJ domains (J-domains) are associated with hsp70 heat-shock system and it is thought that this domain mediates the interaction. DnaJ-domain is therefore part of a chaperone (protein folding) system. The T-antigens, although not in Prosite are confirmed as DnaJ containing domains from literature..
Pfam Number: pfam00226 Score: 284 E_value: 1e-25
Swissprot: Q5R8D8|DNJC7_PONPY

Sequence:
>Contig4577
TTGGCTCCTCCACTCGTTCTCTTGTCCTCTCGTCACCACCTCTACCCCTT
CTCCTTTCCCGCCTCGCGAAACCTGTATCCCACGTTTTTCCAGGTTTATC
TACCAGCCGAACCCTTTATACTCTCACCATTGTACTTGGTTTCCTCAACC
TTTCAGTTTGGGCGGTGTTTATTTCATTTCACTGCCCTCGCCTCGTACCC
GGGACAACTCGAGACTTTTCTCAACGTTTTTTCTTCTTCCGTTTTCCTTT
TCCCTCCCCCCTCTTTCCTTTTTCCCTTACACATCTTGGTCGGTAGAACC
GCACACACTGAAACAGTATCCATGTCTTCTATGGACATCGATTCCGGACC
TCCAGTAACCCCTGGAGGACTAGGAACGCCAACATCTCCAGCTCCAGAGA
CCCCGGCCAAGACAAACGGTGTAAATGGTACACATTTGCTTCCCCCGGAT
CCGCCGAGGGAAGAGCTCGACGGGGAGGCATACAAGCAGGCCGGCAACAA
ATTCTTCAAACAAAAAGAGTACGGAAGAGCTGTCGAGCAGTATTCCAAAG
CCATAAAAAAGGAGCCTGAGAATGCTACATTCTTATCTAATCGTGCGGCT
GCCTACATGTCGGCGGGAAATTTTAACCTCGCTCTGGATGATTGCGTACT
GGCTGATCGCTACGCCCCGTGCAATGCGAAGACATTGCTGAGAATGGCGA
GGATCCAGGTGGCTTTGGGGAGGCCGGAGGACGCTCTGGAGACTTATGGA
AGGATGAACCCCCCGGCTAGCAGCAAGGACAAGGTTCCCGCGATTCAGAT
GAAGCAGCATATCAAGACTGCCGAGGCTTCGGTAGCCGATGGGACTGCGA
GCTCTATGACGCTGTTCGCTATTAATCAGGCGGAAGACTTGCTGGGTACT
GGTGTCGAACCCCCAAAGAAGTGGAAACTCCTTCGGGGGGAGGCAAATCT
CAAGATGAACACTGCGAATTCGTTGGGGGAAGCCCAGAATGTCGCAATGT
CTCTTCTTAGGCAGAATGCACAGGATCCCGATGCCTTGGTTCTTAGGGGC
CGAATTTTGTATGCTCAAGGCGAAAATCAGAAGGCCTCTCTTCATTTTCA
GGAAGCTCTTAGATGCGATCCCGATATGAAGCAAGCCAGGATATTCTTGA
GACGGTCACGGGAGCTTGAGAAAAAAAAGGAGGCTGGAAACGAGGCATTC
AAAAAGGGTGATTACAAGATCGCCCGGGAGCTCTACTCTGAAGCCTTGGC
TGTTGATCCTTCGAATAAAGGGACTAATGCCAAGTTGTACCAGAATCGTG
CCGTTGCTAACACCAAGCTTCAAAATTGGGAAGAAGCTCTCGCGGACTCT
GATGAGGCTATTAAGCTTGATTCGACTTACACCAAGGCCCGCAAGACCCG
GGCGAAGGCTCTAGGACAGATGGGCAATTGGGAAGAGGCAGTTCGCGAGC
TCAAGGCGGTATCTGATGCCAACCCAGGAGATAGCAACATCCGAAAAGAG
ATCAAGGAAGCCGAGCTGGAGTTGAAGAAGAGCAAGAGGAAGGATTATTA
CAAGATTCTTGGTGTGGACAAGACAGCTACCGACGCAGAGATCAAGAAGG
CATACAGGAAGATGGCCATGTTACACCATCCTGATAAGAATCCTGATAAC
GCATCCGCGGCCGAAAAGTTCAAAGATGTCGGTGAAGCCTATGAGACTTT
GTCCGATGCACAGAAACGTGAGATGTATGATTCTGGTGTTGACCTACAAG
ATGATGATATTTTCAGCGGTGGTGGAATGAACCCGGGGATGGGTGGTGGT
GCAATGAATATTGATCCTAATGTATTTTTCAATATGATGGATAATATGGG
AGGCCGTGGCGGCAGCGGAAATTTTTTCCCCGGCGGCGGCTTCCCAGGCG
GCTTCCCAAGTGGTGCAGGAGGAGGGGGGGGGAGAAGAGGGCCACGAGGG
TCCCAAGGTTTCCCGAATTCATTCTCATTTTAGAAGCAAAAGGGCGGGGT
CTAGATTATTGCGATGTAGGGCAATTTGCATGGAACAAATGGTGTTGTCG
TGGGAGTCCGAAAAGCGTTCTGCGAGTGCTGAACGGGATTTGTTTTTTTA
TCATTCATCTCTCTCTCCCTCTCTCCCTTTGTGGTTTCTTAATATCTCGA
ATATGATTCTTACTATTGAGTCTTAGGCGGTACTAGTTTCTTGCCCTATA
TTACTTTTTTTGTGGTTGTCTGCTCATCATCCTCATCATCCTCATCCCTC
TCTTTCTTTCCTTCCTACTCTACCCTGTGACTTCTTTCTTAGGTCGTTTA
TGTTTATCTACTCTTCTCCCCAACCGTGGCGCGCTCAGCATTTTTTCCCC
TTCTCTTTTCTTCACGTGTCTTCATAGGGTGTTCATTTTGATATAAACAT
TGGCGGGTTTTGCGAAGATTGGTTGGTCGGTGCGGTACCGGTATGGCAAC
TATGTTAGAGGGTTTCAAACGCAAAAAGAGGAGACAGTACTGTATTGTGA
GGCTATGGTACCCGAAGGGCGAGCCTTACCCTTCATATCATATACAAAAT
TTAATGGTGATAAG

Sequences in the Contig:

SY0AAA12YA18FM1 SY0AAA17YO23FM1 SY0AAA22YD06FM1
SY0AAA24YD04FM1 SY0AAA24YD04FM2 SY0AAA24YD04RM1
SY0AAA29YA10FM1 SY0AAA39YC16FM1 SY0AAA39YD13FM1
SY0AAA4YF16FM1 SY0AAA55YI02FM1 SY0AAA60YF01FM1
SY0AAA6YP14FM1 SY0AAB13YO05FM1 SY0AAB24YB23FM1
SY0AAB2YP08FM1 SY0AAB37YC05FM1 SY0AAB44YF04FM1
SY0AAB44YN16FM1 SY0AAB50YK17FM1 SY0AAC35YP10FM1
SY0AAC40YJ24FM1 SY0AAC43YD07FM1 SY0AAC51YF13FM1
SY0AAC53YH12FM1 SY0AAC54YH02FM1 SY0AAD12YJ22FM1
SY0AAD12YL02FM1 SY0AAD4YC03FM1 SY0AAD51YL21FM1
SY0AAD63YJ24FM1