Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4576
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00005754001 E-value : 1e-103
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: DUF1760, Fungal protein of unknown function (DUF1760). This is a family of fungal proteins of unknown function..
Pfam Number: pfam08568 Score: 186 E_value: 4e-15

Sequence:
>Contig4576
TTGGGGAGAGAATCGTGACACTCGACAAAGCGATAAATGCGATAAAGACG
GCTGCTGAGGAGATTCCCGCGGACGACTTTATTTCTTACTCTACTATTCT
CGATGTTCACCTTTCATACGCCCACGATGCCTTCTCTCAGGATGAGCAGC
ACAGGCTGTTGGAGGTTTTGGGGGATATTTTAGAGACCCATGTTTGCTAA
TTTTTTCCTGACGTGGACGGTCGGAGTAGATGTTAACGAAGCTGGCGAAT
AGGAAGATCTAGCTCGTGAGATCTCTTGGGATTTGATCTCCGTCTTATTG
CCCTTCCTCGAATCGCTGTCTCCGGCAACCGTTCAGTTGACCGAATCACA
TATTGCGTTCGCAGCGGAAAAAGGAAATCCCCGGGAGGTATTTATCAAGA
TTGTCGAGTCGCTATCTGCGATCAACTGGTCACCACCCCGTGCTGAGGAT
GAAGACGAATATGGCGATGATGATGGCGGTGATGATGACGAGGAAGAGGG
TGGAGAGGTAGGGGAGACTGAAGACAAGTTGAGGAAAGAAACTACCCGAA
ATGCGCTGAGGAAATTCCATGCCTTGTTATCCGCCTTGTCGATTGTTCAC
CCGAGAATATTTACCAAATTTCCCTCGAGGTTTTTATCCACGCAGTTGA

Sequences in the Contig:

SY0AAC35YP05FM1 SY0AAC38YL16FM1 SY0AAD12YH05FM1