Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4575
Length(NT) : 1872
Best Gene Model Blast : Link to GSTUMT00001479001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: UBX domain protein (Ubx5), putative
Accession: ref|XP_001273272.1| Score: 862 E_value: 3e-90
KEGG Definition: UBX domain protein (Ubx5), putative
Accession: afm:AFUA_7G04320 Score: 860 E_value: 3e-90
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1364 Score: 269 E_value: 4e-24
PFAM Definition: No Hit Found
Swissprot: Q06682|UBX5_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig4575
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCGTTACCTTCAAGGCACAACCTAATTGATGATCCTATCCAGA
TCGGCGATGATGAGATAGACGATGGACGATGACGATGACGATTTGAGAGA
AGCATTACGAGCAAGTGAACCCACTAGGTCCACCGCTACACCTGGCAGTG
GGTCCGGGTCTGGTGTTAATTCAGCGTATGATGAGGATGAGGCTATCGCT
AGGAGGTTGCAGGAGGAGCTTTACGGAGAGGCTGGGGGCGCTAGTAGTGG
TGGCGAAAATGGCGTTAGAGCCCCGATTGCAAGAACTAGAGATACCCTTA
TTGGTGGAGATGACTATGGATACCCCGAAGGCATAGCTGAGAGAAGGAGG
CTGAGAGCTGCAACTAGTCGCTTTGGGGCATTTGGTCGACGGAGTGCCGC
AAACGTTTGGGCCCCCGAAAGTACAGATAGTAGTGAGTCACTTTTGGAGG
CTGTTGGAGGGGTTTCTGAATCCTCGTCCAAGCCCAGTAAACTGGCAGAG
ATCTTCCGACCTCCATTCGAGATTATGACCAATTTATCTTTTCAGGATGC
GAGGGATGAAGCAAAGGAGGTGGAGAAGTGGATTCTTGTCAACATTCAAG
ATAATTCTATCTTTTCCTGCCAACTTTTGAACCGAGACATCTGGAAAGCC
CCTGAGGTGAAGGCTACAGTCAAAGAGAACTTCGTTTTCCTGCAGATGGA
TCGTGCGGGGAGGGATGGGAAAGATTATCTCAGACTATACATGGCCAACG
CAGTCGATGACACTGCGCTTTTCTCATCGGGAACCAAAGCCGAGGATGTA
TTTCCACACATTGCGATCATTGACCCCCGAACCGGGGAGCAGGTGAAGGT
CTGGACTGATGTGCCGAAAAATCCCCTAGAGTTTCTCATGGTCCTGCACG
AATTTCTGGATCGCTACTCCCTCAAAGTCGATGCTAAGAACCCCGTTCAA
CGGAAAACCAAGCCTAAAGCTAGCGTTGCCCACATGACAGAGGACGAAAT
GATGCAGCTAGCGATGCAAAACTCGCTCGGTGGCACCAGCACTCCCCTGG
GCGCAACTTCCGACCCCGATGATCTCACTAAGACTGGTGGGGCATCCTCC
GATGTTGGTGACCTAATGGAGTTTGAAGAAGTACAGGAGAACCAAGCCGA
CACGTCTGAAAAACAGGAATCTGTGTTTTGGAGAATTCGCGGGGATAAAC
ATCATGCGGAGCCATTGAGTGGCCCGGATGTCACGCGCATACAGTTTAAG
ATGTCAGATGGCACACGTGTAGTCCGCAGGTTCTTGTTGAAAGATCGCGT
GGAGCGGTTGTTCGAGTACGTGAAAGCAGACCTACTTCCCGAGCACCAAG
AGAAGAGGAAATCCGGCCCCGACGATAAAGAGGACTTGCTGGTGGGGAAA
GAGTTTGAGCTTGTTTCTTTGGGCAAAAAACTCATTGATCATCTTGAAGA
GACCATTGATGAGGCTGGTTTGAAGATGGGGACCGTTATGGTGGAGGTTC
TCGATTGATTGATTATTGATCGGAGACCGGGATGGAGGGGGGGTTCAATA
GACTTTCCTTTATTTCGTGCCTTTTCTTTATTTTAGTGGAAATTCATCCT
TTTTTTACTTTCTCCTATTTCTCTTCTCACCCTTCTGTGGAACTTGCTCT
CTTAGCTTTTATTGGGGAGTTTTGTTGGGCGAAAAAGGGCAGGCTGGTTG
ACGGATATCTTACAAGGATGCGCGATGCGTGAGCAGGTGGACGGAACAAG
AACGAGTGTGGGTGTACTGTATCTAATTAGCACGGACGATTATGTTGCAT
TCATAAACGTTCATTATCCTCC

Sequences in the Contig:

SY0AAB19YG21FM1 SY0AAC13YH21FM1 SY0AAC17YD18RM1
SY0AAC1YB20FM1 SY0AAC21YN17FM1 SY0AAC35YO15FM1
SY0AAC50YG11FM1 SY0AAC51YE17FM1 SY0AAC53YO19FM1
SY0AAC56YE08FM1 SY0AAC62YB11FM1 SY0AAD23YO22FM1