Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4574
Length(NT) : 1313
Best Gene Model Blast : Link to GSTUMT00000712001 E-value : 0.0
Numbers of ESTs : 139

Blast Results:

Nr Definition: hypothetical protein FG08880.1
Accession: ref|XP_389056.1| Score: 357 E_value: 7e-32
KEGG Definition: hypothetical protein
Accession: fgr:FG08880.1 Score: 357 E_value: 3e-32
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1770 Score: 379 E_value: 4e-37
PFAM Definition: SUI1, Translation initiation factor SUI1..
Pfam Number: pfam01253 Score: 243 E_value: 3e-21
Swissprot: P79060|SUI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4574
TTGGGTCCTTGAAGGGCAAGATCGTAGGGAAGAAGGGGTTCCTCCCTACT
CTATCCGGTCGTCTTTCTTTTTCCTTTTTCCTTTTTCCTTTTTCCTTTTC
CCCTCGCTGCTCCATTTCCTTTTCTCACTCAGCACAGCCTTCTACGGGGT
AGCGTAGCAAAGTTGGGTTACCCATAACGCATATGAGCACAGGTAGAGTA
CTCGAGTGGACTATCATAAGGTTTTTGCATAGAACATGATTGGTGGTGGG
GCTCCGTTTGTTTGGTTTGGTTTCGGTTGCTGGGCCTCGTTTTGGTGGGT
TGCTATGATGGCGTGCCGGTACCGGTAGTTTGCGAGTTACATGTTGTGCT
CGTAAATTAGTAAATTAGGAGGGAACCCAGCTGCCAGCCCACTCCAGCCC
TGCTTCGTCGCCATCTGACTGATTTCGCTGTGGCCCAGCGGCGCCTATTT
AAGTTCCACCCCTCTGCCTCCTCCTACGGTACCCCCTTCTCTCTCTCCCC
ACCAAGAACATTCCTGCTTGGCCGCCCTCTCCCTTCGCATTCCCGTCCAA
CACACAAGCTATCACCGGCACAACACTACTACATTTCAAGTCCAAACCAC
TGCTCCGAAGCACCCAGAAACAGCTTTCCCGCATACCCAACCCCCCTCGA
AGTCTGTTTATGTCCATCGAAAATCTCAAGGTTAATGATCCTTTCGCCGA
CGACGTTGGTGATACTCAGCCCAAGAATTACGTCCATATTCGTATCCAAC
AGCGCAACGGTCGCAAGACCTTGACGACTGTCCAGGGGTTGTCTAAAGAA
TACAGTCCTAAAGCTCTTTTGAAAGCTTTCAAAAAGGAATATGCTTGCAA
TGGCACTATTATCCAGGATAAGGACATGGGAGAGGTGATCCAGCTTCAAG
GCGATCATCGTACAAAGGTTATGGACTTCCTTACCGATAAAGGAAGCGAC
AAGATGGGCAAGTACGCACTTGCCAAAGAGAATATCAAGATCCACGGGTT
TTAAGCCCTGCGTCTCCAGCCTTCCTCAACACCGTTTACGTTGGTATTTG
AGGAATGCTTTGCGCTGGAAGACATGTGGGGTTTATTACAGTGTGCATGC
TTGAGATTTCGGGGGTTTGCAGTATACATACTTAATAAAACGTTACTCCA
ACGGATTCTGGCTGGAGGGGGTTTTGTTGGTTGGTTGGTTGGTTGGTTGG
TTGGGGGTGTGTTTTTTTTTCCTTCTTTTTCCCCTCTTCTCGCTGGATGC
CTTGTGAGACTTGGGATTGAGGTAGACTTATCAATAAAATGACCTTAAGT
CGTATTTATTCTC

Sequences in the Contig:

SY0AAA12YB07FM1 SY0AAA13YI23FM1 SY0AAA18YB16FM1
SY0AAA20YB17FM1 SY0AAA24YI14FM1 SY0AAA24YI14FM2
SY0AAA26YB14FM1 SY0AAA26YE09FM1 SY0AAA2YA12FM1
SY0AAA30YA01FM1 SY0AAA30YF19RM1 SY0AAA31YC17FM1
SY0AAA31YC17RM1 SY0AAA33YE05FM1 SY0AAA34YE20FM1
SY0AAA35YF23FM1 SY0AAA35YP05FM1 SY0AAA37YB23FM1
SY0AAA37YJ10FM1 SY0AAA38YK10FM1 SY0AAA39YD22FM1
SY0AAA41YE15FM1 SY0AAA42YM03FM1 SY0AAA47YF04FM1
SY0AAA48YA02FM1 SY0AAA48YK07FM1 SY0AAA48YK24FM1
SY0AAA49YJ18FM1 SY0AAA53YM08FM1 SY0AAA55YC07FM1
SY0AAA5YE11FM1 SY0AAA61YF23FM1 SY0AAA9YE11FM1
SY0AAB10YA16FM1 SY0AAB10YD06FM1 SY0AAB11YF08FM1
SY0AAB12YB18FM1 SY0AAB13YI08FM1 SY0AAB17YB09FM1
SY0AAB22YI15FM1 SY0AAB22YJ22FM1 SY0AAB22YP06FM1
SY0AAB24YF09FM1 SY0AAB24YF23FM1 SY0AAB25YA20FM1
SY0AAB26YA01FM1 SY0AAB27YN09FM1 SY0AAB28YB07FM1
SY0AAB28YG17FM1 SY0AAB2YF06FM1 SY0AAB30YJ23FM1
SY0AAB30YK07FM1 SY0AAB33YO23FM1 SY0AAB34YL18FM1
SY0AAB34YM07FM1 SY0AAB35YI16FM1 SY0AAB37YK03FM1
SY0AAB39YL08FM1 SY0AAB3YP07FM1 SY0AAB40YC13FM1
SY0AAB40YK12FM1 SY0AAB41YA17FM1 SY0AAB42YG08FM1
SY0AAB42YP21FM1 SY0AAB43YC20FM1 SY0AAB44YE15FM1
SY0AAB44YF01FM1 SY0AAB45YD05FM1 SY0AAB50YG11FM1
SY0AAB50YP20FM1 SY0AAB54YP12FM1 SY0AAB58YO08FM1
SY0AAB59YG13FM1 SY0AAB5YP21FM1 SY0AAB61YH03FM1
SY0AAB9YK14FM1 SY0AAC10YB04FM1 SY0AAC12YD14FM1
SY0AAC13YF01FM1 SY0AAC15YL11FM1 SY0AAC18YE06FM1
SY0AAC19YN19FM1 SY0AAC1YM12FM1 SY0AAC21YC07FM1
SY0AAC21YC07RM1 SY0AAC27YC07RM1 SY0AAC30YL09FM1
SY0AAC31YG13FM1 SY0AAC31YJ13FM1 SY0AAC34YK14FM1
SY0AAC34YO09FM1 SY0AAC35YO04FM1 SY0AAC40YL21FM1
SY0AAC41YD15FM1 SY0AAC41YO05FM1 SY0AAC45YN19FM1
SY0AAC48YF15FM1 SY0AAC48YM18FM1 SY0AAC54YK08FM1
SY0AAC56YL02FM1 SY0AAC58YM19FM1 SY0AAC59YK10FM1
SY0AAC6YC08FM1 SY0AAC9YB09FM1 SY0AAD10YJ21FM1
SY0AAD11YG22FM1 SY0AAD13YF08FM1 SY0AAD14YE15FM1
SY0AAD15YA13FM1 SY0AAD15YE09FM1 SY0AAD16YE12FM1
SY0AAD1YG18FM1 SY0AAD23YD04FM1 SY0AAD25YI15FM1
SY0AAD26YL08FM1 SY0AAD26YO15FM1 SY0AAD30YA23FM1
SY0AAD30YE15FM1 SY0AAD32YA21FM1 SY0AAD39YF22FM1
SY0AAD3YK01FM1 SY0AAD40YF12FM1 SY0AAD43YB24FM1
SY0AAD45YP06FM1 SY0AAD48YF15FM1 SY0AAD50YN02FM1
SY0AAD51YE14FM1 SY0AAD52YC06FM1 SY0AAD53YP03FM1
SY0AAD55YA11FM1 SY0AAD55YI05FM1 SY0AAD58YO21FM1
SY0AAD5YC21FM1 SY0AAD5YH16FM1 SY0AAD5YJ17FM1
SY0AAD5YN23FM1 SY0AAD63YG23FM1 SY0AAD63YO03FM1
SY0AAD8YL20FM1