Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4573
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00011664001 E-value : 1e-153
Numbers of ESTs : 3

Blast Results:

Nr Definition: pre-mRNA splicing factor
Accession: ref|XP_001247216.1| Score: 411 E_value: 8e-39
KEGG Definition: HAT repeat protein
Accession: aor:AO090001000722 Score: 401 E_value: 6e-38
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0495 Score: 534 E_value: 1e-55
PFAM Definition: PRP1_N, PRP1 splicing factor, N-terminal. This domain is specific to the N-terminal part of the prp1 splicing factor, which is involved in mRNA splicing (and possibly also poly(A)+ RNA nuclear export and cell cycle progression). This domain is specific to the N terminus of the RNA splicing factor encoded by prp1. It is involved in mRNA splicing and possibly also poly(A)and RNA nuclear export and cell cycle progression..
Pfam Number: pfam06424 Score: 479 E_value: 3e-49
Swissprot: Q12381|PRP1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0000398 = Biological process: nuclear mRNA splicing, via spliceosome

Sequence:
>Contig4573
TTGGGTAATATCAACTGAACGATAAACCCCCGAGATGATGAAACGTAACT
TCCTCGATGAGCCAGCACCGGCAAACTACGTCGCTGGTCTCGGTCGTGGT
GCTACTGGATTCACAACACGATCTGATATTGGTCCCGCACGTGAAGGCCC
TTCAGAAGAAGCTATCAAGGCCGCCCTCGCGCGAAGAGCTGAAGCGTTAG
GACAGGCCCCACCGACTGCCTATGGTGCGGATAAGAAGAAAGACGATGAT
GACGATGACGACGATCGATTTCAAGACCCCGAGAATGAAGTTGGACTTTT
CGCTGGAGGAGCATACGACGAAGACGATGACGAGGCAGATAGGATATATC
AAAGTGTAGATGAGAAGATGGAAAAAAGGCGAAAGTCACGAAGGGAAGCA
CGTGAGAAAGCCGAGCGCGAAGAATACGAGCGTAAGAATCCAAAAATTCA
GCACCAATTCGCTGATTTGAAGAGAGGACTGGAAACCCTCACCGACGACG
ATTGGGCGAGCTTACCAGAAGTGGGGGATCTTACGGGGAGGAATAGGAGG
GCGAGACAAGCCATG

Sequences in the Contig:

SY0AAC35YM16FM1 SY0AAC55YJ05FM2 SY0AAC61YF03FM1