Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4571
Length(NT) : 2174
Best Gene Model Blast : Link to GSTUMT00003320001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein BC1G_13929
Accession: ref|XP_001547598.1| Score: 275 E_value: 4e-22
KEGG Definition: hypothetical protein
Accession: ani:AN2770.2 Score: 264 E_value: 4e-21
KOG Definition: No Hit Found
PFAM Definition: HPC2, Histone promoter control 2 (HPC2). HPC2 is required for cell-cycle regulation of histone transcription. It regulates transcription of the histone genes during the S-phase of the cell cycle by repressing transcription at other cell cycle stages. HPC2 mutants display synthetic interactions with FACT complex which allows RNA Pol II to elongate through nucleosomes..
Pfam Number: pfam08729 Score: 304 E_value: 4e-28

Sequence:
>Contig4571
TGTACAAAAAGTTGGCGTATCTGGTAGTGTATGGTACAGGTAGGCAAGCG
GCAGCGGTAGAAAACCGTACCGGTAGTCGCGGCGGGCGAGAGGAGCCTCT
AGCTCAAGGATAGGACTCGTTCCACTCAACCTCGACCGCACCACAACCAC
AAGCAGAGGTACCATTGCACCACCACCACCACAACCAGAACCATCAGCAC
CACAACCACCACCTTTAGGAACGCGTTAGAAGGGAGTGTGTGAACAAAGG
GTCAGCGGGGAGTTCGAATGAATGAGGGAAAAGTAAAACGAGGGAGGCGA
GTTGTGCACTTATATACCTCACCGTGAAGCGCATATACATAAAAATACTA
ACTTACTAACTAAACTCAAACCCTCCTCTCCTTCCGCCCTGCTCTGCCTG
TCTACCATTCTCGTTGCACACACAATCCCGTTCCCTCTCTTTCTCCATTC
TCTGTAGTTGCTCTCTTGTCCGCGGCGGTTGCTGCCCATAACCTAGCACG
CACAACCGCCATTCCACCCATTCTTACAGCAGAAACAGAAGCTGCTGTTA
CTTCCTAGTCCCTCTTCTGTTGCCATGATTGCAAATTAATCTTTCTTTTC
CCATGAAAGCCAAATGACTGTTGGTTGAAAAGCTTCTGACGTTCTGAAAA
AGTCCACATTCTGGCCACGCAGCCCTCGGTCTCTTTTCTCTTCTCCATCT
CCTTTCTCTAGCTCTTTGTCTTTCTATTCCTCTCCTTCTTCTCCTTCTCT
TCCCCTTCTTCCTCGTCTTCTCTATTCTTCTGCGATCAAAACAACTTCCA
ACACCCCCTCCTCGTTCCCTATTCCTCCCTATTCCGCACAAATTCCTTCG
CGCTTCTTGTTCTCTCATCTTTACCCTCCCTTAAACACTCACATCTAATT
TCCCCATTCACATTCCCTTCTTCACCCTTCACAATCATCGCCAGCTCCCT
CTCGACTTCCGCCCATCATTTCTGTTCCCAACGAAAGAAGAGGAAAGCTC
CAAAATTCTCCTGGAGGTATTTTTTCGTGTTAGAGCCTTTATTCAACAGG
CTGGGGTAACCCCATCCTGGCATCTCTCAGAGTAATAAAATTACAAATCG
AAAATTCTCGCGATGTCCACGTTTGGGAGTCCCTCAGCCATGACTCGTGG
TGTTCAATCGTCGCCTTCATCTAAACCCGCCTCGCCAACCGCTGGTAATG
TTTCCGACAAGTCAGCAAATAATTCAAATAGAGGTACCCACACCAACAAC
CATCCCTTGTCAACCTCGTCACCACTCCATCGTCAACCAAAATTTCCACA
AGATGTGGTCGACTCTTCGGGCCGCATCACCAACAACCATAACGGCAAAA
AATCAGCACCGCATACGGGGCCATCGCGCCCACGTCAAGAAATTATTGAG
CTTGATAGCGACACGGAACCAAATAGCGCCTCGGGAAAATTGAACTCATC
TATCGCCCCTTCAGCAAGGAATAGATCTCTCCTCGGCCAACCGTTCGATC
CTGTTAGGAGTGGATCCACTGCTAAATCCGGCCATCGTGCTTCCGCGTCG
CCTTCTATATCCTCGCTGATCGACCCGCAGCCACTAACCGAACCTCATGC
CGCGGCCTTATCGTCCGACAAGCAATTCAATTCGTCCTTCGCTTCGGACA
CTGCTGTCGGAAATGGTGTGAGGGTAGAGAAATTGCCGCGATCCGGCGAG
GTGGGGGATTCACTAAACCGATCGCCGAAATCGAAAAATGGTACAGCTCC
TTCTTCTGCAGCTGCATCTCCCAAACCCCGACCGTCTCTGCCTTCGACCT
CTGGCAATGGATTATTATCGGGTGTTTTACCAGGTACGACTGCTGCTACT
AGCGAAGCATGTATCCCCAACATTTATATTCATGTTCCTCTCAATGGGGA
GCACAACAAATATGTTAACTTTGCTAAACTGGCGGAGGAGCGTTACGGAT
GGGCAGCTTTGAACCCAAAGCTCGCGAGAGCTAGGGAAAATATGATGAAA
GGGGACAGTGGTGATGAGATGATGGTTGATGGCTCGGAATCGGAGTCGAA
TATTGAAATGGATAAGCCGATGGACTCCGAAGGTGGGAAGCGAAAAAAGA
GAAGGCATCAAGACATTTATGACAAAAACGACCCCTTCATTGACGATACC
GAGATGCTTTGGGAAGAGCAAGCT

Sequences in the Contig:

SY0AAA31YK20FM1 SY0AAA32YE12FM1 SY0AAA38YF23FM1
SY0AAC27YH22FM1 SY0AAC35YL23FM1 SY0AAC44YD20FM1
SY0AAC51YK12FM1 SY0AAC55YM16FM3 SY0AAD2YJ03FM1
SY0AAD41YO15FM1 SY0AAD61YF10FM1