Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4570
Length(NT) : 474
Best Gene Model Blast : Link to GSTUMT00000577001 E-value : 3e-97
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: hypothetical protein
Accession: ddi:DDBDRAFT_0189891 Score: 124 E_value: 5e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4570
TTGGCCAACTTTTTTGTACAAAGTTGTCGCTGAAAAAAAAAAATACTCAC
TCAAAAGTTCTTTATAAAATATACCCCCTACCCCACGATTAAGATAGTTA
TCATGGACGTTTAGTTCCTCTCCCCGATACAACCTCAAACCTCGTTTTCC
CACGCTTGTACCCCTGTAGAATCCTTCACCACGCCTTCCCCAGAGATCTA
CGGACCTCTGAGCCCTTCGCTTAGCGACATTACCCCACAACAGCCAGTCA
CCATTCTTCCCTCGGAACCATTGTGTTTCCCTCCAAACGACCAGCCATGG
CCCTCCACAACCCCTCACCAGAGGCTTTCGCCGCAAGTACTAGCCTCAGA
CTCGCTTCCACCGCTGCCCCCGACTCCCAGATCAGTTTCGACGATCCCGT
GCTCTTTCCTCAGCGAGCGCAACCATCCCCGCGTACTCTCCCTAATCAGC
TGCAACAGTCGCAACAACAATCAC

Sequences in the Contig:

SY0AAC35YL13FM1 SY0AAD38YP19FM1