Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4569
Length(NT) : 1368
Best Gene Model Blast : Link to GSTUMT00009292001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61528.1| Score: 668 E_value: 6e-68
KEGG Definition: aromatic amino acid aminotransferase and related proteins
Accession: aor:AO090102000498 Score: 668 E_value: 3e-68
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0634 Score: 471 E_value: 9e-48
PFAM Definition: No Hit Found
Swissprot: O14192|AATR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4569
TTGGGTCCTCCTGTCTTCCGTGAAGTCTGGCTAGCAAAGTAAGTCGGATC
GCTAGTTAGCTTAGGTTATGGTACGAACGGGAGATGCGATAAGGTACACT
ATCATCAGCTTCCCCATCAGATCAACCGACGTCAACAATTATCAGTCAAT
CAATCAATAACCCGCCCAACACCTTGTTTGCCAGGCAATATATACAGCCC
TGCGTCACCAGGTTAGGAGACCAATTATCTTATTCCCCATCTTCAGCTTC
CTTCCCTCTTCCCCTTCTCCATTGCCACCATTACCACCTCCATCATCCCC
ATCCATCATTGTCCTCTTGTTCCCTCCCTCGCACCTTCGAATAGACGAGA
TGGCTCGACATCCCCACCCTGTTTCTGGCCAGCTAGAGCCCAATCGGGAA
CACGCGAAGCCGTCGGATCTGTCCCACCACTTTAACCGTGTTACCCGTGA
GCGAACTGCAAGTGCAATCAAGAACTTGTACAAATATTTCCAGGCCCCAG
GAATGATAAATTTGGCCGGTGCTCTACCGTTCCCCGGGTACTTTCCCTAT
GATACATTGGAATCCGCTGTCTCAACTTCAGGTCGCTTCCCCGCAAACCT
TATCGAACAGCTTAACAAACCGATTCCCGTACTCTCCACCTCTCCGCCAC
CTCCTCCTAAAAGATCATCCCCCCTGTTTTCTTTCTTCAGGCCATCACCG
TCTCCGTCACCGGCTGCCTCCCCCACACCAAGGAAGACCTCAGGGAGTCC
CGGCACAAGTTCCTCACATCTGATTGTTCCGAAATTCAAACCTGGAGGCC
CACCGGGAGGCAGTATTGATGTTGCTACGACATTGCAATATGGCCAAGCT
TCCGGCTTCGGTCCATTGGCCGAATTTATCAAAGACTTTTCGATTAATCA
TCTCCATGGCGGGAGGATCCCATATGAGAATCCGGAAATACTTCTGACGT
GTGGTAATACCGATGGTTTTGGGAAGGTGATGCAAATGATTGCCGAGAGG
GGTGACAGCATGCTCGTGGAGGAGTACACATATCCGAACGCTATCCAGAC
AGCTGACCCCTATGGTGTAAACATATCACCTATCAAGGTGGACGCTGAGG
GAATGCTATCTGAAGGAAAAGGAGGTCTTAGAGATGTTCTCGAGAATTGG
GACCACAGAAGATTCGGTAGAAGACCTCGCTTAATGTACACTATCACAAT
CGGTCAAAACCCCACCGGCGCCACACTTTCTTTGCAGCGCAGAAAGGAAA
TCTACCGTTTGTGTGAGAGATACGATGTGATCATTATCGAAGATGATCCG
TACTGGTATCTCCAGTATACTGAATCCTCGCACCCCAAGGACGCCCAAAC
CCTGCCAGCCAACTCTAC

Sequences in the Contig:

SY0AAB29YH13FM1 SY0AAB33YB22FM1 SY0AAB33YH13FM1
SY0AAB36YI17FM1 SY0AAC35YL10FM1 SY0AAC38YL20FM1
SY0AAD60YG23FM1