Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4568
Length(NT) : 995
Best Gene Model Blast : Link to GSTUMT00005258001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001536612.1| Score: 725 E_value: 1e-74
KEGG Definition: hypothetical protein
Accession: ang:An17g01750 Score: 723 E_value: 8e-75
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53584|YTP1_YEAST

Sequence:
>Contig4568
TTGGGGGGAGAGGAATTCTGTCTTTTACTCTTTTCCTTCTCTTCTCTTCC
TTCTTGCAGTACGGTACTCGAATACCGGTACTGTACTGTACAGTGCTGGC
ACCCTAGTACCGTATTGAGCACTATCAAGCCTGATCGATCTACCGTACAG
AACTTCACAAAGCGTCCCATTGCATGCACAACCTTTCCTTCCATCCATAG
AGAATAACACACCCCTCCCTGCCCTTTCATATCCTGCCCCATCATACAAG
CTCTCCCCGGCAAAACGAAAATAAAGTAAAGAATAAAACCCAACATGTCC
CTCCATCGGTACCTGCCGGCTCTCCTTCTGTCGTTGGGCACTGGCTTAGT
ACCAGTAACTGCTCACGAGCACCACACAGAAGGAATCCCGGAGGGAGAAG
TGGTCTCTCCCGATCCCCTAGATTCGATACTATGGATCCACATCTTCACA
ATGATAACCGCCTTCGGAATGGTTTTCCCCTTCGGAATGGTCCTGGGGAT
TGCTAGGAGCAGGTGGCACGTTCCTGTACAGGTTCTGGGAACCGTCCTGG
CGGTTCTGGGCTGGCTGCTCGGGCATGCGCACGGGGGGAGGCAATTCGCG
CCGAACATTCACGCAGCCTTTGCGTCGTCGTTGATGAGCATGTTGGCACT
ACAGGTCGGCTTGGGGGTCTATCTGAAGTTGCACTTGGAGAAGGGATGGC
ATAGCGTTGTCAGGTGGCATCTGGTTCGCTTGCATGGCATTGTCGGGAAG
GTGATGCCTGTGGTGTCCTGGACACAGATGCTGTTTGGGGGGATCACGGC
GCTAGGGTTTTGCCGAGCAGATCACCAAGGGCAATGCTTAGCGCATTTTA
TTATGGGCAGCTCGTTCATAGGGTATGGCATAATCATGGTGATTATGCTT
TTTGCTGGCCAAGCTTGGTTAAAGAGGACTGCAAGGTCCCAGGAATTCTG
GGATTCTTTAGTGATCACCGTTTGGGGATGTGTAAACTCATTCAC

Sequences in the Contig:

SY0AAA15YN15FM1 SY0AAB10YH21FM1 SY0AAB1YI16FM1
SY0AAC33YN18FM1 SY0AAC35YK20FM1