Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4566
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00002137001 E-value : 1e-148
Numbers of ESTs : 2

Blast Results:

Nr Definition: possible swi2/snf2-like protein
Accession: emb|CAD28443.1| Score: 160 E_value: 2e-09
KEGG Definition: SNF2 family helicase/ATPase PasG, putative
Accession: afm:AFUA_1G13010 Score: 160 E_value: 8e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4566
TTGGCGGCAAGCGCCGCCTGGAAAAGCTGGTCATCCAGAAGGGCAAGTTC
AGGAGCGTCTCCGCCCCCTCAGCCTTGGAGGAGGAAGAGCTCGCCCAGAT
CCTCAAGGAGGACTTTGAGAAGGTCAATGTCGTTGAGCAGGGCACGCAGT
TGCTCACCGATGCAGAGCTAGAGACTTTAATGGATCGCAGTCCCGAAGCG
TACTCGCGCGCTGCCAAAGGTAAGGAAGAGGCTAGTGGGGCGTTTAGAGT
CGTGGAGACCGGGGCGAAGGAGGAGGAGGAGGAGGAGGCCCAGGGAGCCG
ATGGTAGTGCTGGTGATGGGACCGGCGGAGTTTAGCTTCCTCGACTTTCC
CTTTTGAAGGAAGCAAGGAAGGAGCAGTTAATGTCATATACTTGCCTTTT
TTTTTCCTTATTTTCTTTCCTTCTACTCTCACTTTTTTCTTCTTTCCGCA
AACAAATTTTACCATTAGGTGATACAGTAGACGTGCTAGCGGTGATCCAG
TGTTCTTTTATTTATTGCTTTTCGCGGATCTTTTGGTACCTCTTTCATTC
TAGTTTCCTCTTCATGTTTAGTTGACTCATCTTACTATTTGTCACAGAAC
ACTGGATCATTGCTTTCTCATTCCCGTTTACATTCCCAGCTAGCTAGTTA
CTTCCCTTACCTACATTAGTCCTCCCGCTTACCTCCC

Sequences in the Contig:

SY0AAC35YK17FM1 SY0AAD51YD03FM1