Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4565
Length(NT) : 973
Best Gene Model Blast : Link to GSTUMT00004562001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001638836.1| Score: 504 E_value: 4e-49
KEGG Definition: NEMVEDRAFT_v1g88429; predicted protein
Accession: nve:NEMVE_v1g88429 Score: 504 E_value: 2e-49
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0895 Score: 440 E_value: 2e-44
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 264 E_value: 6e-24
Swissprot: Q9NR09|BIRC6_HUMAN
Gene Ontology:
GO:0006916 = Biological process: anti-apoptosis

Sequence:
>Contig4565
TTGGGGCACAGCATGGTTCAAGTTATGTCGAAACTAAGCACTCAAGCTAA
GGTCTTCCTTAATTGTGTGGGGAAGACAAAGGGGGACGAGTTTGAAGGGA
CGGAGGCGGCAAAAACTCTCAAGATTTGCATGGAAATCGCTGCTATCGGG
GAAAAGCTTCTCAAACTCTCATCCCGTAACGCGAGCAATCAAAATAGATC
ATCCTCCATTTCTTCCAAGAGTATTGAGGCGCCCCCCCAGATCACATCCC
CACCCGCGGCTCCGGTCTTGGACCTAGGATATCATGACGGGATGGCGTTT
GAGTACGTTGAGGGTGTCGTCACAACACATTATTGGAACTCACAGGCGAC
TAGCCTAACTACCAGTCCGAGGGGCCGAGTTCTTCACCTAAGCAGAGAGA
TGGCCACAATGAGCACCAGCCTTCCGCAAGGGGTTTTTGTCAGAGTTGAA
GATGGTAGGCCAGATATCATAAAGGCCATGATCGTTGGTCCTTGTGAAAC
GCCGTATGAGGGCGGGCTTTACGAGTTTGACATCTGGGCTCCTGCGAATT
ACCCGAGTGGTCCACCAATGTGCCAATTCAAGACCACTGGGAACGGGACT
GTTCACTTTAACCCAAATCTATATAATTGCGGAAAAGTGTGCCTCTCCAT
CCTTAATACTTGGTCCGGCGCTTCTTCCGAACGTTGGCAGCCGGGAACTT
CCACCTTGCTCCAGGTTTTTGTCTCCATCCAGTCCATGATACTTTGCGCG
GCCCCTTGGTACAATGAACCCGGACGGCGTGAAGGAACCCGGAAAAAGGA
TGCCGAGGAGTTCAACAGCCGAGTCCGTGTCAACAGTGTCAAATGGGCAA
TGCTTGATTGGCTCAAGGACTCTTCCAAGAGGAATGGCATTTGGAAGGAC
GTGATTGAAGCACATTTCAAGGCCAACCAGGGGTATCTACTCGAGCTCGT
CAAAGAATGGGCCAAGAAAGATC

Sequences in the Contig:

SY0AAA32YE16FM1 SY0AAB34YA07FM1 SY0AAC33YG19FM1
SY0AAC35YK11FM1 SY0AAD19YI20FM1 SY0AAD50YI15FM1