Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4564
Length(NT) : 771
Best Gene Model Blast : Link to GSTUMT00005100001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: COP9 signalosome complex subunit 12
Accession: ref|XP_001212922.1| Score: 446 E_value: 1e-42
KEGG Definition: hypothetical protein
Accession: ang:An01g03590 Score: 429 E_value: 7e-41
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG2688 Score: 194 E_value: 6e-16
PFAM Definition: No Hit Found
Swissprot: Q4WJX0|CSN12_ASPFU

Sequence:
>Contig4564
TTGGTTTCCAAACACGTTCATTTGAGCCTCTTATCCCACTTCTCATGTTA
TCACCACCACCACCGCCCAATATAAACATCACTAAAACATAGCATCTTCA
TCATGACCACACTCTATAAAACGTTTCGTAGAGCATTGACTACCAAGGAC
GGTGCTCTACTCGGCAGCATCTTCTCCCCCGAAAATCCGGACCGCGGAAC
ATTCGCCTTCTCTACTAATCACGAGAGGATTCGCGGCGACGTCGAATACG
AAATCTCCGGTCTGACCCCCTTACGCGATGAGAATACCAGAGCTGCCTGG
ATCGACACCTTGGTCTGCTACTGGAAGATAGCGTACATTCTGGAGCGGGA
CGATGGGGCAGATGTGAGTTGGGCGAAGGCTTACGAGGGGCAGAAGGATC
TTTTACTAGTTATGGTTAGGGGCTATACAAAGGGGAACTGGCCGCATTGG
ACACTTCCCGTCATGTACCAGATTTGTCTGTCTTTGAGAACTGTTGCTAT
ATTATCGGATGACCAAGCGCGAAGACTTGGGAAGGCCTCGGAACACCTTG
AGGATGCGGCGAGGTATATTAACAAGGCCTTTACATTATGTATCAGCGAC
CGCGCCCCTATTGAGGAATCGAGAAAATGGGGAACTTATTATATTGTTAA
CCTCATGTTCAAAACTTACTTCAAGTTAAATTCTGTCGGTCTAGCAAAAA
ACATACTTCGTGTGCTTCCTGCTTCCCTTGCTGACATGCCACCTTTGGAA
GCATTCCCCAAAAGCCACATT

Sequences in the Contig:

SY0AAC16YM08FM1 SY0AAC35YK03FM1