Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4563
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00002721001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_07084
Accession: ref|XP_367159.1| Score: 315 E_value: 2e-27
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07084 Score: 315 E_value: 8e-28
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1068 Score: 245 E_value: 7e-22
PFAM Definition: RNase_PH, 3' exoribonuclease family, domain 1. This family includes 3'-5' exoribonucleases. Ribonuclease PH contains a single copy of this domain, and removes nucleotide residues following the -CCA terminus of tRNA. Polyribonucleotide nucleotidyltransferase (PNPase) contains two tandem copies of the domain. PNPase is involved in mRNA degradation in a 3'-5' direction. The exosome is a 3'-5' exoribonuclease complex that is required for 3' processing of the 5.8S rRNA. Three of its five protein components contain a copy of this domain. A hypothetical protein from S. pombe appears to belong to an uncharacterised subfamily. This subfamily is found in both eukaryotes and archaebacteria..
Pfam Number: pfam01138 Score: 159 E_value: 6e-12
Swissprot: Q9P7R3|YHV8_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4563
TTGGACCACAACTTTGCCCAACTCTGCTTACAACTACGCTCCCCATCTTC
TGATCTACGAAATACCGTCATGACGGATCGCCGACGCATCAATGGCCCGC
TGGAGGGCACTATACCGCCGGTATTCCTCACTAGCTCGACTCATAAATCA
ATAATTAAACGTTCACCAACTACTCTTCGAAAAATCTTTCTGAAAACCGG
CCTAACTCCACCCGCAACGGGCTCTGCATTCTTGGAACTCCCGACACCCT
CCACCCATTCAACACCCACTCTAAAGCTCACCTCGAGTGTCTACGGTCCC
CGGCCCTTGCCTTCATCAACAACCTTCTCCTCAAACGCGCGCCTGACCGC
CGAACTCAAGTTTTCGCCGTTTTCCACTCCCGGCCGCCGTCGCGGGTATA
TTCGTGACGGTGTGGAACGCGACCTTTCCGCGCAACTATCTATCGCCCTT
GGAAAAAGTGTGGCTGTCGGAAAGTATCCCAAGAGTGCGATTGACGTATT
TGTTAGTGTGCTTGACTGTGAGGGTGGACTGGGGGATGCAGGAGATGAAG
CAGGTGGTGGGGTGGATGTGGGATTAATGAGTGTGCTTGCTACAGCGATT
AGTTGCGCTAGCGCAGCTATTGCAGATGCTGGGATTGAGTGCTTTGATCT
TGTGGCGGGGGGCGT

Sequences in the Contig:

SY0AAB11YP10FM1 SY0AAC24YD15FM1 SY0AAC27YI12FM1
SY0AAC29YJ06FM1 SY0AAC35YK01FM1