Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4562
Length(NT) : 1666
Best Gene Model Blast : Link to GSTUMT00003110001 E-value : 9e-91
Numbers of ESTs : 14

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG4726 Score: 114 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4562
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAACGCGATTCCAGATTGT
GCGAGTACAGTACAGAATGCGCACTGTCCGGGTCATCTGGCAAGGTCACT
GCCCGATGCCCGCCACCCCCCTCGCTCGCTTCGTGGGAGCGTACCCCCAC
CGCCCGCCAACCTCGGCAGCCCTGGGAAGGCAGCCGGAGTGCAAGAAAGA
AAGAAAAACTAACACGCGAAGCACAGAAACGAGAAAAAAACACCACAGCC
GACGCCTACCGCAGCAAGCACCACGTCAAAAGTCTCGAGTGGAGCCTTGC
CATCCGACCATCTGACAAAATAATCTATTCAGATCATTCCTTCCTTCTCT
CCAAACTCCAACGCCAGGAAACAACGAGGCATTCTTAGCAAGCTAGGCGG
ACTGGAAGGAAGGGAGGGAGGACAGGGGGCGGAGGCCGGGTCTGCGGGAG
TCTCTGGCTTTGTTGGAGGTGTAGAAGGAGGCGCTGGATGTTGAACTGAA
GGTCTGCTGCTAGCTGTGTGTGGCTATGCCCCCCCGGCATTGGGGAAGGG
TGCTCTTAAGCCCCTCCCTGCCGCCCACCACGATACGCATCACGAGTTAA
TACCTGCGTCCCCGCCCTATTTTCTACGGACTCTCGCCCTAACTTCAACT
TACGCTGAAAGATTTGCGAGTTATTTAGGGTGCGACAGTGGTAATGCCTC
ATTATCGGTAACAACTTGCGGAGCGATTTCCCAGGTAACTCTGAGCGTTG
GCCTAAATCTAATTGCAACCCCCTACTGAGCCTCTTAGGCCCGAGGCTGC
TTGAACATCTGCCTGGCCGCCGCCGCCCCTTTGGACGGAAAGTCTTCGAA
TGTGGCTGCCAGTGGTGGTGGTCATGTGTAAGGTACGTCCGGTCTCTTTG
GTCGGCCGTGTTTACACTTAATGGAATTACATGCATAGCAATCTGGTTAT
GGGGGGGGGGTAATGTATAAGTTGCCCATCCATCCACCACCACTGCACCC
ATTACACCACTGCACTATTCCTGACTCGCCCTACTACTATACAGCACCTT
GCACCCAGTATTTTAGGAGCCAGTTCCCCCCCCTCTCACTCTCCCTCTCG
CTGCGTCCCCCACACCAACCACCAGACATCGGTCCACCCACGCATCAAGC
ATCCCATACCTGCCTACCAATAACAATTCTATTCACCTGCTACCTCCTTT
ACCAGTACCCCCTCTACCAACTGCCTTTCGATATGACCAAACAATACGAA
CAAGAACAATCGAACAAGCGGGTTGGCGATGCGGCAATCGAGTTGGGCAT
ACCAAGAGATTGGGTTAATGATCCGTACAGAGGCCTCACCCCCAGAGAGA
GGTTCGTGTGGCAGCAAGACGGTCCCCAAGACCGATCAATGCTAGGTCAC
CAGCAACAGCAGCAACGGCAGCAACAGCAGCAGCAACAGCAACAGCAACA
GCAAAGAGGACGCTAGAGCTGTCCACCCCGCAACCTACACGAAGCCTTCC
TTGGTCCTCACCCTCATAATAAGGGCTGCAGGCTCTGTCGCTCACTACCG
ACTTATAATCTACCGCCAGCCTATCTTTGCTTCCCTTCCCCGGGGATGTC
ATCAACGCTTTCATCCGATCACCAAGCGACGCTCGACCTCCCCCTAAACA
TTTCCTTGCCAATCCC

Sequences in the Contig:

SY0AAA22YE19FM1 SY0AAA22YO20FM1 SY0AAA23YO20FM1
SY0AAA43YN09FM1 SY0AAA9YP21FM1 SY0AAB10YC04FM1
SY0AAB1YK21FM1 SY0AAB1YN12FM1 SY0AAB50YB08FM1
SY0AAB53YH04FM1 SY0AAC15YN03FM1 SY0AAC16YH09FM1
SY0AAC35YJ17FM1 SY0AAD27YJ07FM1