Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4561
Length(NT) : 1890
Best Gene Model Blast : Link to GSTUMT00009362001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001209520.1| Score: 381 E_value: 2e-34
KEGG Definition: predicted protein
Accession: aor:AO090012001018 Score: 360 E_value: 2e-32
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4561
TTGGGCCGGGATCTACTTCCAGCACTCCCCGTCATACTCTCCAATCACCC
AGCAAAGCAGTGGGAAACAAGACGATCCCGAAGAGCGCTCTTGGCGGCAA
CACCACCCCCAAGACTGTGTCAGCTAAAACGGTGAGCAAGCGACCGGTCA
GTCCGAAGCCATCTGGCTCTCGCGTCTCATCAAAATATCCGACCCCGTTA
GAATCAGGCCCCTCGCTAGTTGTTAGGTTAAAGTTCAGCCGCCGTCGCAT
CAAGGACGTTGTAAGTTTGTTACGGTTGAAACCTAACCCTAAACGAGTTC
GCCAAGACGAGGATCAGCACTTATCGGCGCCTCCTGCCAAACGGCAGAAG
GGGACCGAAAACCTGAACCCTTCCGCCACGAGATCTCCCGCGTTCAAGTC
TCCGGCACTGAAGGCGCCCAAGGAGCGTGACATTATTACGCCTCCGAAGA
AACTTAACGGCAGTGCGTCATTGAAACGATCGGACTCTGAGGGACGTGTC
CATACGCCGGCCAAGGCAGAGAGAAACGGAGGGAGAAATGGTGTGGGTTC
AGGAGCTCCGCCCAAGGAGTTGACTCCTGCTATTTTGGCGGAGGCTAAAG
GGCTTAGGAAGGAATATTCCAGATTTTCTGAGTTCGGGAAACATGCCAAA
TATGAAGCTGATAGAGTCTTCAAGTCACTGGACGGGCCAGCAGCTGACCG
GGACAAGCTCCGATATGCTACCGTCGTTCTTACTGATTCAGTTTTGTGTT
TCATGGTCTCCTTCTCCTTCGAGCAGGAAGCGAAAGTGCTGGAACGTCGT
TCCCCACCGGTGGAAATGTGGAAGTCGATTATTCCGCTCTGTCTCTTTGT
CGGCGACAAAGCCGTGCCATACCCATCCCTCTTCGGTCTCATTAAGCAAC
TTGAAGCCGTGGTCCGCCAACACATCTTTGACCTCGAAATAGCGCAGTAC
GATAAGATGCCCATCCCAGACACAACCTCCAAAGCGCCAACCCCCGACTC
GGGCGGAAATACCGCCGGCGACCAGATGAGGGCCTACCAGTCCTTCAAAT
CTGCCCTCACGAAATCTTCCCGTGAACTGAAGGACTGCTGGCTCGTTGGC
AATAAGGGGCTCACGTACGATGACATACAAGCCAAGTTCCCGCAGACCTA
TGCTTTGAGGAGTAAGAAGTTTATCCATCCTAGTGCTATCAATGTTAAGA
ACGGGCAGTTCAGGCAGGCATACCAATTGCCCTTGCATAGGAATTCGACT
ATGCTCGAGGCGGTGAACTTTGGATATTTCTTTTTGCTGGAGTGGGTCGC
TGGAGAGGGGATTAAGTTTCAGAGTAGGCTGGCGGAGACATTTCGGTAAT
GGGGATAAGGGATGAGGGAGCGGCTTAACCGCTCTGGTGGATGTGATGTT
TTTCAACGGGATCTCTTTTCATAAAACCTTTGCGTGTTTTTTTTCGGGCT
TTTTCGGTCTTGTCTTGTATTGGTGTTATTGGGATGGCGGGGCCCGGGAT
GGGTTTGCTTTACTTTACTCCACTTTGCTCACTTCTTTTACTCGTTTCTT
TCTTTCTTTGTTTATTTTACCTCTTCTTTGCTCTTTTGTTGACCTTTTTT
TACGGCTTGGGTTGTTTTATCCATCATGTCGCTTTTTGCTTGCTTTCTTC
AAGAATGCCTTTCAACTACTCCACCTTTACTTTTATTCTTCTACCCTACT
ACCCTACTCCACTTTTATCCTTACTTTTATGTTTCTTCTGTTTTTCACTT
CACTTCACTTCACCTTTTAACTGCATAATGTCTTTTTTCCCTTTCCTTTC
CTTGTAAGAAACGGCTTATGACTTTTCTTTTTCTATTTCATTTGACTGTC
CTACCTCACTTCACCTCACATCACCTAACCTCAGTTAACC

Sequences in the Contig:

SY0AAA10YC04FM1 SY0AAA59YI17FM1 SY0AAB21YA13FM1
SY0AAC25YH11FM1 SY0AAC32YA06FM1 SY0AAC35YJ16FM1
SY0AAC35YN09FM1 SY0AAC47YK23FM1 SY0AAC53YI20FM1
SY0AAC5YG23FM1