Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4560
Length(NT) : 830
Best Gene Model Blast : Link to GSTUMT00011921001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_09191
Accession: ref|XP_001551856.1| Score: 332 E_value: 2e-59
KEGG Definition: hypothetical protein
Accession: ang:An02g11230 Score: 324 E_value: 9e-58
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3220 Score: 296 E_value: 9e-28
PFAM Definition: CoaE, Dephospho-CoA kinase. This family catalyses the phosphorylation of the 3'-hydroxyl group of dephosphocoenzyme A to form Coenzyme A EC:2.7.1.24. This enzyme uses ATP in its reaction..
Pfam Number: pfam01121 Score: 290 E_value: 5e-27
Swissprot: Q03941|YD196_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005739 = Cellular component: mitochondrion
GO:0005635 = Cellular component: nuclear envelope

Sequence:
>Contig4560
TTGGCGCCAACAAACAAACCAAAATGCTTCTAATAGGCTTAACCGGCTCC
ATCTCGACCGGGAAATCCACCGTATCAAAGATCCTCTCCAAGGACCACGC
ACTCCCAATAATCGATGCAGATCAGCTCGCACGGGAGGTGGTGGAAGTGG
GTACGCCGGGGCACACCTCCATAGTAAGGTACTTTTCCGAGAGCACACCA
GGCCTGCTGAACGAGGACGGGACGCTAAACCGCGCGGTCCTAGGCCGGCG
CGTTTTCGGCGACGATCCGGAGAGGAGGAAGGATCGGGGGGTGTTGAATG
GGATTGTGCACCCGCTTGTTAGGAAGGAGATGTTGGTTTCCTCCTCACTC
CCCCCCCCCGCGTGGGCTTTTGTTGACATAAGAGGAATGACATAGGTATA
AAGCAATAGCGTACCATTACCTCTCCGGCGCCTGGGCCGTCGTCCTGGAC
ATCCCTCTACTCTTCGAGTCCTCCTTTGACCTAATCTGCGGTGCGGTCCT
CGTCGTCTCCGTTTCCTCCCCGGAAGTACAGCTCGGGCGATTACTCGCCC
GCGACGCCCATCTCACGCGCGAGGACGCGGAAAAGCGCGTGGCATCGCAG
ATGAGCATTCAGGAGAAGGTCGAACGGTGCGATAGGGTGTTTGGTGGTGC
GCGAGGAAGGGGAGCGGCCATCTCAAATGATGGGAGTGTCGAGGAGTTGC
GAAAGGGGGTTACGAGTGCTGTGGAGGGGTTGAAGGCGGGTAGGGATGGG
TGGTGGAAGTGGATGCTTTGGGGGTTGCCGCCGGTGGCTGGGGTCGTTGG
GGCGAGGGTTCTCGCGGAGAATTGGGCCAA

Sequences in the Contig:

SY0AAA48YC22FM1 SY0AAC35YJ10FM1