Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig456
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00007461001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: ubiquitin/79aa fusion protein
Accession: ref|XP_001538961.1| Score: 585 E_value: 9e-59
KEGG Definition: hypothetical protein
Accession: ang:An02g07010 Score: 579 E_value: 2e-58
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0004 Score: 651 E_value: 5e-69
PFAM Definition: ubiquitin, Ubiquitin family. This family contains a number of ubiquitin-like proteins: SUMO (smt3 homologue), Nedd8, Elongin B, Rub1, and Parkin. A number of them are thought to carry a distinctive five-residue motif termed the proteasome-interacting motif (PIM), which may have a biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites..
Pfam Number: pfam00240 Score: 280 E_value: 6e-26
Swissprot: P61864|UBIQ_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0016567 = Biological process: protein ubiquitination
GO:0042254 = Biological process: ribosome biogenesis and assembly
GO:0006412 = Biological process: translation

Sequence:
>Contig456
TTGGGAAGACGCAATTATTGCTGAGCTGTGGTTAATCGGTTTACCCTCTC
TCAATATATCGAAATATTGAAGATTGTATAGCCTAACTTGCATTTTTTTC
AGACAACAATGCAAATTTTCGTTAAGACCCTCACGGGTAAAACTATCACC
CTTGAGGTTGAGTCTTCGGACACCATCGACAATGTCAAGAGCAAGATCCA
GGATAAGGAAGGAATTCCCCCAGATCAACAGCGTTTGATCTTCGCTGGGA
AGCAGCTTGAGGACGGTCGCACCCTTTCGGACTACAACATCCAGAAGGAG
AGCACCCTTCATCTCGTCCTCCGCCTTCGTGGTGGTGGTAAGAAGCGCAA
GAAGAAGGTTTACACCACCCCAAAGAAGATCAAGCACAAGCGCAAGAAGA
CCAAACTCGCTGTCCTTAAGTACTACAAGGTTGATGGTGACGGCAAAATC
GAGCGTCTGAGACGCGAATGCCCAACTGAAGGGTGCGGTGCCGGTGTCTT
TATGGCTGTTATGACCAACCGCCAATACTGTGGCAAATGCCATCTCACCT
ATGTCTTCGACGATGCTTAGGTTATGTCTTCAGGGTAGGGAGGAAGCAAT
CGCGGTGCATATGTAATACCATCTTGTTGTGGTTGAACGAAAATAAATAA
ATCAAGGCCTTTTCCTAGCCCATATCTAGGCTA

Sequences in the Contig:

SY0AAA24YG10FM1 SY0AAA24YG10FM2 SY0AAA24YG10RM1
SY0AAA41YH02FM1 SY0AAA57YO12FM1 SY0AAA63YP24FM1
SY0AAB11YB12FM1 SY0AAB22YJ11FM1 SY0AAB34YC01FM1
SY0AAC22YO14FM1