Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4559
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00011298001 E-value : 1e-106
Numbers of ESTs : 2

Blast Results:

Nr Definition: purine nucleoside phosphorylase I, inosine and guanosine-specific
Accession: ref|XP_747545.1| Score: 306 E_value: 1e-26
KEGG Definition: purine nucleoside phosphorylase I, inosine and guanosine-specific [EC:2.4.2.1]; K03783 purine-nucleoside phosphorylase
Accession: afm:AFUA_6G05320 Score: 306 E_value: 7e-27
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG3984 Score: 260 E_value: 9e-24
PFAM Definition: Mtap_PNP, Phosphorylase family 2..
Pfam Number: pfam00896 Score: 208 E_value: 1e-17
Swissprot: Q9UTG1|PNPH_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4559
TTGGCCAACAACCCCCAGACCACACACACCATGTCGGAATCATTCTACGC
CCGGGCCACCGAATCAGCGAATCATGTCCGTAACCTCCTCCCGGAGGAAT
TGAAGAATCCCCATGTGGGCATCGTTTGTGGATCAGGGCTTGGAGGTTTG
GCTGGGATGCTGGACCAGGAAGAATTGTTCGAGCTTTCGTATAAGAGCAT
TCCCCATTTCCCGCATTCGACTGGTTTGTTTTGTCTCCTGCGGAGCTTTC
GTGCTGTGCTGATCGGGAGTGGGCCGCATCAGCTGTCGGCCATGCTGGTA
AGTTTGTCTTTGGGCTTTTGGGGGAGAAGAAGACTCCTGTGGTGGTTATG
GTGGGCAGGGTACAGTATGGCTTTCTTGGTTCCTTTGTTGGAGATTTCAG
AGAGGGTTAATTGGGTGGGGCATAGCTACTTTGAAGGTCACTCCATAGAG
AAGGTTACCTTTCCTATGAGGGTTATGAAGTTGCTTGGGATTCATACTGT
TATTGTTACGAATGCTGCTGGGGGGCTCAATAGTGAATTCTCCGTGGGAG
ATATTATGGTTTTAAACGATCATATCAACTTCCCTG

Sequences in the Contig:

SY0AAC35YJ06FM1 SY0AAD61YG21FM1