Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4558
Length(NT) : 755
Best Gene Model Blast : Link to GSTUMT00007946001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4558
TTGGCCAATCCGCGGAGAAGTTTTCGCTCTTTAGATCCCTCGACTCCTCC
CCCTCACACAGCTAAAGAAAGTTCCCTACCGAGCCCAACCATTAATAAAA
TTCTTTACAATCCCACGTTTACGGGCCGACCGGACCTACTCCCTCAGTGA
TGCGCTTTCCACGCAGCTACTTGCGGGTTGACCTCACCAAACTTTTCTGT
GAGGATTCAGATGGCTCAGGGCACTCTGAAGATGGAGGAGAGATTGTGTG
CTCCAGAGAGCGGAAGCCGGGGGAGGAAAACGGTCCAAATGAGTATCACC
CCAAAAAGGAGAATGTTGATTCGAGGGCAAAGATGTCTCCTCAAGTCAAA
CCCCTGCCAACCCAAGAGCTCAAATCAATACCCAACGACAGACTCGTCCG
AGGTGCCTCAAATGCTGAAAATAAGTCTCAAGTGAAACCCTCCTGCGGAG
AAAAGAGCAAGGAGAAAACCTACCGGATTCAAACGATTGGAGAGGTTTAC
GCTCTACAGAAACGTGAGGGTAAAGAACCGCCTACATTCAAGGGAATCAA
GGAAAGTCGGTCCAGAAATGGTGTAGCCGGGCGTTTGACTTCGCGAAGAA
TTAACGAACCCCTCCTCATGGCTACAGGATACGCTTCCTACAAATGCGGG
AATTCTGTCAGGGGGGAAGGGTGGCATGGGGATTGGAGTAACGACTTTCT
ATTTGGATATCATGACCCGCGCGAGAACGAAGCTTATACTATTCAGCTTC
CTGAT

Sequences in the Contig:

SY0AAC35YI07FM1 SY0AAC36YI07FM1 SY0AAD15YD03FM1
SY0AAD17YM09FM1 SY0AAD47YF02FM1